Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_1839 [new locus tag: NWMN_RS10570 ]
- pan locus tag?: SAUPAN004928000
- symbol: gatC
- pan gene symbol?: gatC
- synonym:
- product: aspartyl/glutamyl-tRNA amidotransferase subunit C
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_1839 [new locus tag: NWMN_RS10570 ]
- symbol: gatC
- product: aspartyl/glutamyl-tRNA amidotransferase subunit C
- replicon: chromosome
- strand: -
- coordinates: 2047508..2047810
- length: 303
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5331940 NCBI
- RefSeq: YP_001332873 NCBI
- BioCyc:
- MicrobesOnline: 3707427 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCACAAGAATTAGCTTTGAAAAAT
GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACTTG
TAA60
120
180
240
300
303
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_1839 [new locus tag: NWMN_RS10570 ]
- symbol: GatC
- description: aspartyl/glutamyl-tRNA amidotransferase subunit C
- length: 100
- theoretical pI: 4.09552
- theoretical MW: 11309.5
- GRAVY: -0.672
⊟Function[edit | edit source]
- reaction: EC 6.3.5.-? ExPASyATP + L-glutamyl-tRNA(Gln) + L-glutamine = ADP + phosphate + L-glutaminyl-tRNA(Gln) + L-glutamate? ATP + L-aspartyl-tRNA(Asn) + L-glutamine = ADP + phosphate + L-asparaginyl-tRNA(Asn) + L-glutamate?
- TIGRFAM: Protein synthesis tRNA aminoacylation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)and 1 moreputative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
- TheSEED :
- Aspartyl-tRNA(Asn) amidotransferase subunit C (EC 6.3.5.6)
- Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7)
- PFAM: GatC-like (CL0735) GatC; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 81.7)and 2 moreGta3; Glutamyl-tRNA amidotransferase complex subunit Gta3 (PF20978; HMM-score: 21.5)no clan defined DUF6137; Family of unknown function (DUF6137) (PF19634; HMM-score: 17.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9981
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.0017
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003484
- TAT(Tat/SPI): 0.000302
- LIPO(Sec/SPII): 0.00075
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: gatB < gatA < gatC
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]