Jump to navigation
Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_2208
- pan locus tag?: SAUPAN005783000
- symbol: NWMN_2208
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_2208
- symbol: NWMN_2208
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2428573..2428650
- length: 78
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 5331332 NCBI
- RefSeq: YP_001333242 NCBI
- BioCyc:
- MicrobesOnline: 3707810 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61ATGAAAGTAATCGTTAACGCTTCTTTTTTAATCGTAATATTAGCGATTGTAGTGGCATAT
TTTTTATTGTCTAAGTAA60
78
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_2208
- symbol: NWMN_2208
- description: hypothetical protein
- length: 25
- theoretical pI: 10.2476
- theoretical MW: 2765.5
- GRAVY: 2.116
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- FIG01108068: hypothetical protein
- PFAM: no clan defined CydS; CydS-like protein (PF22282; HMM-score: 14.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0005
- Cytoplasmic Membrane Score: 0.9718
- Cell wall & surface Score: 0
- Extracellular Score: 0.0277
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 4
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.173752
- TAT(Tat/SPI): 0.008153
- LIPO(Sec/SPII): 0.151375
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKVIVNASFLIVILAIVVAYFLLSK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]