From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05225 [old locus tag: NWMN_0933 ]
  • pan locus tag?: SAUPAN003277000
  • symbol: NWMN_RS05225
  • pan gene symbol?: purE
  • synonym:
  • product: 5-(carboxyamino)imidazole ribonucleotide mutase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS05225 [old locus tag: NWMN_0933 ]
  • symbol: NWMN_RS05225
  • product: 5-(carboxyamino)imidazole ribonucleotide mutase
  • replicon: chromosome
  • strand: +
  • coordinates: 1036113..1036577
  • length: 465
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (1036113..1036577) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGGCAGTTCTTCCGATTGGAAAATTATGCAAGAGAGTTGTAACATGTTGGATTATTTT
    GAAATTCCGTACGAAAAACAAGTAGTATCCGCACATCGTACGCCAAAAATGATGGTTCAA
    TTTGCTTCTGAAGCGAGAGAAAGAGGTATAAACATTATCATTGCAGGCGCTGGCGGTGCG
    GCACATTTACCAGGTATGGTTGCATCATTAACGACGCTACCAGTTATTGGAGTGCCGATT
    GAAACAAAAAGTTTAAAGGGTATAGATTCTTTATTATCAATTGTTCAAATGCCAGGAGGT
    ATTCCGGTTGCAACGACTGCAATTGGTGCAGCAGGTGCTAAAAACGCAGGTATACTTGCA
    GCAAGAATGTTAAGTATTCAAAATCCTTCTTTAGTTGAAAAACTAAATCAGTATGAATCT
    TCGTTAATTCAAAAAGTGGAGGACATGCAAAATGAACTTCAATAA
    60
    120
    180
    240
    300
    360
    420
    465

Protein[edit | edit source]

Protein Data Bank: 3ORS

General[edit | edit source]

  • locus tag: NWMN_RS05225 [old locus tag: NWMN_0933 ]
  • symbol: NWMN_RS05225
  • description: 5-(carboxyamino)imidazole ribonucleotide mutase
  • length: 154
  • theoretical pI: 5.73089
  • theoretical MW: 16427
  • GRAVY: 0.114286

Function[edit | edit source]

  • reaction:
    EC 5.4.99.18?  ExPASy
    5-(carboxyamino)imidazole ribonucleotide mutase 5-carboxyamino-1-(5-phospho-D-ribosyl)imidazole = 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate
  • TIGRFAM:
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis phosphoribosylaminoimidazole carboxylase, catalytic subunit (TIGR01162; EC 4.1.1.21; HMM-score: 209.7)
  • TheSEED:
  • PFAM:
    no clan defined AIRC; AIR carboxylase (PF00731; HMM-score: 205.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.017895
    • TAT(Tat/SPI): 0.009563
    • LIPO(Sec/SPII): 0.001159
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_072353889 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MGSSSDWKIMQESCNMLDYFEIPYEKQVVSAHRTPKMMVQFASEARERGINIIIAGAGGAAHLPGMVASLTTLPVIGVPIETKSLKGIDSLLSIVQMPGGIPVATTAIGAAGAKNAGILAARMLSIQNPSLVEKLNQYESSLIQKVEDMQNELQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]