From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS09240 [old locus tag: NWMN_1646 ]
  • pan locus tag?: SAUPAN004431000
  • symbol: NWMN_RS09240
  • pan gene symbol?:
  • synonym:
  • product: 16S rRNA pseudouridine(516) synthase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS09240 [old locus tag: NWMN_1646 ]
  • symbol: NWMN_RS09240
  • product: 16S rRNA pseudouridine(516) synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 1834293..1834988
  • length: 696
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (1834293..1834988) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAGAATAGATAAATTTTTAGCAAATATGGGCGTCGGTACACGTAATGAGGTCAAACAG
    TTACTTAAAAAAGGCCTTGTAAATGTCAACGAACAAGTAATTAAATCACCAAAAACACAT
    ATAGAACCAGAAAACGATAAGATAACAGTTCGTGGAGAATTAATAGAATACATTGAAAAT
    GTCTATATTATGTTAAATAAGCCAAAAGGTTATATATCAGCAACTGAAGATCATCATTCA
    AAAACCGTTATTGATTTAATACCTGAATACCAACATCTAAATATTTTTCCGGTTGGTCGT
    CTTGATAAAGATACAGAAGGGCTTTTATTGATAACGAATGATGGTGATTTTAATCATGAA
    TTAATGAGTCCAAACAAACATGTTTCTAAAAAATATGAAGTTATTTCAGCAAATCCTATC
    ACTGAAGACGACATTCAAGCTTTTAAAGAGGGTGTAACACTGACTGATGGCAAGGTTAAG
    CCTGCAATATTAACTTATATTGATAATCAAACGTCACACGTAACAATTTATGAAGGAAAA
    TATCATCAAGTTAAACGAATGTTTCATAGCATTCAAAATGAGGTATTACATTTAAGACGT
    ATCAAAATTGCTGATTTAGAATTGGACAGCAATTTAGATTCAGGAGAATATCGTTTATTA
    ACTGAAAATGATTTTGACAAATTAAATTATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    696

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS09240 [old locus tag: NWMN_1646 ]
  • symbol: NWMN_RS09240
  • description: 16S rRNA pseudouridine(516) synthase
  • length: 231
  • theoretical pI: 6.35246
  • theoretical MW: 26615.1
  • GRAVY: -0.545455

Function[edit | edit source]

  • reaction:
    EC 5.4.99.-?  ExPASy
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification pseudouridine synthase (TIGR00093; EC 5.4.99.-; HMM-score: 152.9)
    and 4 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification pseudouridine synthase, RluA family (TIGR00005; EC 5.4.99.-; HMM-score: 41.5)
    Unknown function General TlyA family rRNA methyltransferase/putative hemolysin (TIGR00478; HMM-score: 23.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification pseudouridine synthase Rlu family protein, TIGR01621 (TIGR01621; EC 5.4.99.-; HMM-score: 18.1)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS4 (TIGR01017; HMM-score: 17.2)
  • TheSEED:
  • PFAM:
    PseudoU_synth (CL0649) PseudoU_synth_2; RNA pseudouridylate synthase (PF00849; HMM-score: 66)
    and 1 more
    S4 (CL0492) S4; S4 domain (PF01479; HMM-score: 41.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004965
    • TAT(Tat/SPI): 0.000675
    • LIPO(Sec/SPII): 0.000892
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 447139869 NCBI
  • RefSeq: WP_001217125 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MRIDKFLANMGVGTRNEVKQLLKKGLVNVNEQVIKSPKTHIEPENDKITVRGELIEYIENVYIMLNKPKGYISATEDHHSKTVIDLIPEYQHLNIFPVGRLDKDTEGLLLITNDGDFNHELMSPNKHVSKKYEVISANPITEDDIQAFKEGVTLTDGKVKPAILTYIDNQTSHVTIYEGKYHQVKRMFHSIQNEVLHLRRIKIADLELDSNLDSGEYRLLTENDFDKLNYK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]