From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS14950 [old locus tag: NWMN_2611 ]
  • pan locus tag?: SAUPAN006488000
  • symbol: NWMN_RS14950
  • pan gene symbol?: gidA
  • synonym:
  • product: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS14950 [old locus tag: NWMN_2611 ]
  • symbol: NWMN_RS14950
  • product: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
  • replicon: chromosome
  • strand: -
  • coordinates: 2874610..2876487
  • length: 1878
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (2874610..2876487) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    GTGGTTCAAGAATATGATGTAATCGTTATAGGTGCGGGACATGCAGGTGTAGAAGCAGGT
    TTAGCATCTGCAAGACGTGGTGCTAAAACATTAATGCTAACAATAAATTTAGATAATATT
    GCATTTATGCCATGTAACCCATCTGTAGGTGGACCAGCTAAAGGTATCGTTGTTCGTGAA
    ATTGATGCTTTAGGTGGACAAATGGCAAAAACAATCGATAAAACACACATTCAAATGAGA
    ATGTTAAATACAGGTAAAGGACCTGCTGTAAGAGCACTAAGAGCGCAAGCAGATAAAGTA
    CTTTATCAACAAGAAATGAAACGCGTGATTGAAGATGAAGAAAATTTGCATATAATGCAA
    GGTATGGTAGACGAACTTATTATAGAAGATAATGAAGTTAAAGGTGTACGTACAAATATT
    GGTACAGAGTATTTATCTAAAGCAGTAATTATTACAACGGGAACATTTTTACGTGGTGAA
    ATCATTTTAGGTAATATGAAGTATTCAAGTGGACCAAATCACCAATTACCATCAATCACA
    TTATCAGACAATTTAAGAGAACTTGGTTTTGATATTGTTCGTTTTAAAACAGGTACACCA
    CCGCGTGTAAATTCAAAAACAATTGACTATTCGAAGACTGAAATACAACCAGGTGACGAT
    GTAGGTCGTGCATTCAGCTTTGAAACAACAGAATATATATTAGATCAATTGCCATGTTGG
    CTAACGTATACTAATGCTGAAACACACAAAGTTATCGATGATAATTTACATCTATCTGCA
    ATGTATTCAGGGATGATTAAAGGAACCGGGCCACGTTATTGCCCTTCAATTGAAGATAAA
    TTTGTTCGATTTAATGATAAGCCGCGACATCAACTTTTCTTAGAGCCTGAAGGTCGTAAT
    ACAAATGAAGTATATGTGCAAGGATTGTCTACAAGTCTTCCTGAACATGTGCAACGTCAA
    ATGTTAGAGACGATACCAGGTCTTGAAAAAGCAGATATGATGCGTGCCGGCTACGCAATT
    GAATATGATGCGATTGTGCCAACGCAGTTATGGCCTACACTTGAAACGAAAATGATTAAA
    AACTTATATACTGCAGGTCAAATTAATGGTACATCTGGTTATGAAGAAGCAGCAGGACAA
    GGATTGATGGCAGGTATTAACGCTGCAGGTAAAGTGTTAAACACAGGCGAAAAGATATTA
    AGTCGTTCAGATGCATATATTGGTGTCTTAATCGATGATCTTGTAACTAAAGGTACTAAT
    GAACCTTATCGTTTACTAACATCACGTGCAGAATATCGTTTGTTACTACGTCATGATAAT
    GCTGATTTGAGATTGACGGATATGGGATATGAACTTGGTATGATTTCTGAAGAAAGATAT
    GCACGTTTTAATGAAAAACGTCAGCAAATTGATGCGGAAATTAAGCGTTTATCAGATATT
    CGTATTAAACCAAACGAACATACGCAAGCGATTATTGAACAACATGGTGGTTCTCGCTTA
    AAAGATGGTATTTTAGCTATCGATTTATTACGCAGACCTGAAATGACTTACGATATAATT
    TTAGAACTTTTAGAAGAAGAACATCAATTGAATGCAGATGTTGAAGAACAAGTAGAAATA
    CAAACAAAATATGAAGGTTATATCAATAAATCACTACAACAAGTTGAGAAAGTTAAGCGT
    ATGGAAGAGAAGAAAATTCCAGAAGACTTAGATTATAGTAAGATTGATAGTTTGGCGACT
    GAAGCGCGAGAAAAATTATCAGAAGTAAAACCTTTAAATATTGCACAAGCTTCTAGAATA
    TCAGGGGTAAATCCAGCAGACATATCTATATTATTGATTTACTTAGAACAAGGTAAACTC
    CAAAGGGTGAGTGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1878

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS14950 [old locus tag: NWMN_2611 ]
  • symbol: NWMN_RS14950
  • description: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
  • length: 625
  • theoretical pI: 5.14884
  • theoretical MW: 70115.6
  • GRAVY: -0.3928

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 955.7)
    and 20 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 59.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 23.6)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 23.3)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 22.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 22.9)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 20.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 19.6)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 16.2)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 15.4)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 14.7)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 13.6)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 13.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 12.1)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 11.2)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 10.7)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 10.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 9.7)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 8.1)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 7.9)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 563.2)
    and 7 more
    no clan defined GIDA_assoc; GidA associated domain (PF13932; HMM-score: 267.7)
    NADP_Rossmann (CL0063) FAD_binding_2; FAD binding domain (PF00890; HMM-score: 22.7)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 22.4)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 20.2)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 15.1)
    Thi4; Thi4 family (PF01946; HMM-score: 11.8)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 10.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.020853
    • TAT(Tat/SPI): 0.007512
    • LIPO(Sec/SPII): 0.007355
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446171807 NCBI
  • RefSeq: WP_000249662 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MVQEYDVIVIGAGHAGVEAGLASARRGAKTLMLTINLDNIAFMPCNPSVGGPAKGIVVREIDALGGQMAKTIDKTHIQMRMLNTGKGPAVRALRAQADKVLYQQEMKRVIEDEENLHIMQGMVDELIIEDNEVKGVRTNIGTEYLSKAVIITTGTFLRGEIILGNMKYSSGPNHQLPSITLSDNLRELGFDIVRFKTGTPPRVNSKTIDYSKTEIQPGDDVGRAFSFETTEYILDQLPCWLTYTNAETHKVIDDNLHLSAMYSGMIKGTGPRYCPSIEDKFVRFNDKPRHQLFLEPEGRNTNEVYVQGLSTSLPEHVQRQMLETIPGLEKADMMRAGYAIEYDAIVPTQLWPTLETKMIKNLYTAGQINGTSGYEEAAGQGLMAGINAAGKVLNTGEKILSRSDAYIGVLIDDLVTKGTNEPYRLLTSRAEYRLLLRHDNADLRLTDMGYELGMISEERYARFNEKRQQIDAEIKRLSDIRIKPNEHTQAIIEQHGGSRLKDGILAIDLLRRPEMTYDIILELLEEEHQLNADVEEQVEIQTKYEGYINKSLQQVEKVKRMEEKKIPEDLDYSKIDSLATEAREKLSEVKPLNIAQASRISGVNPADISILLIYLEQGKLQRVSD

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]