COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

⊟Summary

• organism: Staphylococcus aureus Newman
• locus tag: NWMN_RS15595
• pan locus tag^?:
• symbol: NWMN_RS15595
• pan gene symbol^?: —
• synonym:
• product: short-chain dehydrogenase

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: NWMN_RS15595
• symbol: NWMN_RS15595
• product: short-chain dehydrogenase
• replicon: chromosome
• strand: -
• coordinates: 2607600..2607686
• length: 87
• essential: unknown

⊟Accession numbers

• Location: NC_009641 (2607600..2607686) NCBI
• BioCyc:
• MicrobesOnline:

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  
  ATGAAACGTTTGGAAAATAAAGTAGCAGTCGTAACAGGAGCAAGTACAGGTATCGGTCAA
  GCTTCTGCAATCGCTTTAGCTCAATAA
  60
  87
  

⊟Protein

⊟General

• locus tag: NWMN_RS15595
• symbol: NWMN_RS15595
• description: short-chain dehydrogenase
• length: 28
• theoretical pI: 10.789
• theoretical MW: 2785.24
• GRAVY: 0.407143

⊟Function

• TIGRFAM:
  Metabolism Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 25.1)
  Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 23.9)
  and 8 more
  Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 16.7)
  3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 16.4)
  rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 16.1)
  Metabolism Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 13.8)
  2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 13.8)
  Metabolism Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 13.3)
  sepiapterin reductase (TIGR01500; EC 1.1.1.153; HMM-score: 13.2)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll light-dependent protochlorophyllide reductase (TIGR01289; EC 1.3.1.33; HMM-score: 12.1)
• TheSEED:
• PFAM:
  NADP_Rossmann (CL0063) Eno-Rase_NADH_b; NAD(P)H binding domain of trans-2-enoyl-CoA reductase (PF12242; HMM-score: 20)
  adh_short; short chain dehydrogenase (PF00106; HMM-score: 19.3)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: unknown (no significant prediction)
  • Cytoplasmic Score: 2.5
  • Cytoplasmic Membrane Score: 2.5
  • Cellwall Score: 2.5
  • Extracellular Score: 2.5
  • Internal Helices: 0
• LocateP:
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.402791
  • TAT(Tat/SPI): 0.068103
  • LIPO(Sec/SPII): 0.117247
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI:
• RefSeq: WP_000824926 NCBI
• UniProt:

⊟Protein sequence

• MKRLENKVAVVTGASTGIGQASAIALAQ

⊟Experimental data

• experimentally validated:
• protein localization:
• quantitative data / protein copy number per cell:
• interaction partners:

⊟Expression & Regulation

⊟Operon

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: no data available

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications