Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0053 [new locus tag: SA_RS00410 ]
- pan locus tag?: SAUPAN000139000
- symbol: radC
- pan gene symbol?: radC
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0053 [new locus tag: SA_RS00410 ]
- symbol: radC
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 61269..61586
- length: 318
- essential: no DEG
⊟Accession numbers[edit | edit source]
- Gene ID: 1122827 NCBI
- RefSeq: NP_373293 NCBI
- BioCyc:
- MicrobesOnline: 102319 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAAGGAAATCAATATTGTTTCACTACAAATGATAAAAACAGATACATTAAGTTATCTA
AAAAATCGTATTTCAAACCCTGAGGATGCGGCAGAAATCATGCGTTCATTCATTGGAAAC
AGTGACCGAGAGCATCTCATTCTCATATGTATGAACAGTAAAAATGAACCTACACATATT
CAAACACTATCGATTGGATCTATTAACCAAACGGTGATTCACCCTAGAGAAATATTCAAA
ACAGCGATACTCAGTAACGCAAATAGTATAATGCTCGGTCATAATCATCCAAGTGGAGAT
GTATTAACCATAGTATAA60
120
180
240
300
318
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0053 [new locus tag: SA_RS00410 ]
- symbol: RadC
- description: hypothetical protein
- length: 105
- theoretical pI: 7.07163
- theoretical MW: 11738.5
- GRAVY: -0.087619
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair DNA repair protein RadC (TIGR00608; HMM-score: 70.6)
- TheSEED:
- PFAM: JAB (CL0366) RadC; RadC-like JAB domain (PF04002; HMM-score: 82.2)
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007083
- TAT(Tat/SPI): 0.000238
- LIPO(Sec/SPII): 0.000405
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKEINIVSLQMIKTDTLSYLKNRISNPEDAAEIMRSFIGNSDREHLILICMNSKNEPTHIQTLSIGSINQTVIHPREIFKTAILSNANSIMLGHNHPSGDVLTIV
⊟Experimental data[edit | edit source]
- experimentally validated: no data available
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: radC < SA0054 < SA0055 < SA0056
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]