From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0317 [new locus tag: SA_RS01825 ]
  • pan locus tag?: SAUPAN001862000
  • symbol: SA0317
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0317 [new locus tag: SA_RS01825 ]
  • symbol: SA0317
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 374594..375619
  • length: 1026
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAATAATAAAGTATTAGTAACCGGTGGTACAGGGTTTGTTGGCATGCGAATTATTTCA
    CGATTATTAGAACAAGGTTATGAGGTACAAACAACGATACGTGATTTAAGTAAAGCTGAT
    AAAGTAATTAAAACAATGCAAGACAATGGCATTTCCACAGAGCGATTAATGTTTGTCGAA
    GCGGATTTATCACAAGATGAACATTGGGATGAAGCAATGAAAGATTGTAAATATGTCTTG
    AGTGTAGCATCTCCGGTGTTTTTCGGTAAAACAGACGATGCAGAAGTGATGGCGAAGCCT
    GCCATTGAAGGCATACAACGTATTTTAAGAGCTGCAGAACATGCTGGCGTGAAGCGTGTG
    GTGATGACTGCAAACTTTGGTGCAGTTGGTTTTAGCAATAAAGATAAAAATTCAATCACA
    AATGAAAGTCATTGGACAAATGAAGATGAACCAGGCTTATCAGTATATGAAAAATCAAAA
    TTGTTAGCTGAAAAGGCAGCGTGGGATTTTGTTGAGAATGAAAATACAATAGTAGAATTT
    GCCACAATCAATCCAGTTGCAATTTTTGGACCATCATTAGATGCACACGTTTCAGGAAGT
    TTCCACTTGTTAGAAAACTTATTAAATGGTTCAATGAAACGTGTACCGCAAATTCCATTG
    AATGTTGTTGATGTGAGAGACGTAGCTGAACTACACATTTTGGCAATGACAAATGAACAG
    GCTAATGGCAAGCGATTTATTGCTACAGCTGATGGACAAATTAATTTGTTGGAAATTGCA
    AAATTAATTAAAGAAAAGAGACCTGAAATAGCTCAAAAAGTTTCTACTAAAAAATTACCA
    GACTTTATTTTGAGTCTAGGTGCTAAATTTAATCATCAAGCTAAAGAAGGTAAACTTTTA
    TTAGATATGAACCGCAATGTAAGTAACGAACGTGCAAAAACATTACTTGGTTGGGAACCG
    ATTGCGACACAAGAAGAAGCAATTTTAGCAGCAATTGATAGTATGGCTAAATTTCATTTA
    ATATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1026

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0317 [new locus tag: SA_RS01825 ]
  • symbol: SA0317
  • description: hypothetical protein
  • length: 341
  • theoretical pI: 5.90426
  • theoretical MW: 37800.1
  • GRAVY: -0.186804

Function[edit | edit source]

  • TIGRFAM:
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 121.5)
    and 20 more
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 49)
    thioester reductase domain (TIGR01746; HMM-score: 46.7)
    Metabolism Energy metabolism Sugars UDP-glucose 4-epimerase GalE (TIGR01179; EC 5.1.3.2; HMM-score: 40.2)
    UDP-N-acetylglucosamine 4,6-dehydratase (inverting) (TIGR03589; EC 4.2.1.115; HMM-score: 31.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides dTDP-glucose 4,6-dehydratase (TIGR01181; EC 4.2.1.46; HMM-score: 25.9)
    Hypothetical proteins Conserved TIGR01777 family protein (TIGR01777; HMM-score: 25)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 25)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides ADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 24.1)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 21.6)
    Metabolism Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 21.2)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides dTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 18.8)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 18.5)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides CDP-glucose 4,6-dehydratase (TIGR02622; EC 4.2.1.45; HMM-score: 18.3)
    UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase (TIGR04130; EC 4.2.1.-,5.1.3.-; HMM-score: 18.1)
    2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 15.2)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis putative 3-oxoacyl-(acyl-carrier-protein) reductase (TIGR01831; HMM-score: 13.9)
    Unknown function Enzymes of unknown specificity putative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 13.1)
    2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 13)
    ergot alkaloid biosynthesis protein, AFUA_2G17970 family (TIGR03649; HMM-score: 13)
    Cellular processes Cellular processes Toxin production and resistance putative thiazole-containing bacteriocin maturation protein (TIGR03693; HMM-score: 12.8)
  • TheSEED:  
    NAD-dependent, hopanoid-associated epimerase/dehydratase family acting on nucleotide-sugars
  • PFAM:
    NADP_Rossmann (CL0063) 3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 89.6)
    and 10 more
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 68.3)
    NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 60.8)
    GDP_Man_Dehyd; GDP-mannose 4,6 dehydratase (PF16363; HMM-score: 50.5)
    NmrA; NmrA-like family (PF05368; HMM-score: 45.2)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 40.8)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 28.3)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 26.6)
    Polysacc_synt_2; Polysaccharide biosynthesis protein (PF02719; HMM-score: 22.6)
    KR; KR domain (PF08659; HMM-score: 18.6)
    Ldh_1_N; lactate/malate dehydrogenase, NAD binding domain (PF00056; HMM-score: 12.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007773
    • TAT(Tat/SPI): 0.000324
    • LIPO(Sec/SPII): 0.000781
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNNKVLVTGGTGFVGMRIISRLLEQGYEVQTTIRDLSKADKVIKTMQDNGISTERLMFVEADLSQDEHWDEAMKDCKYVLSVASPVFFGKTDDAEVMAKPAIEGIQRILRAAEHAGVKRVVMTANFGAVGFSNKDKNSITNESHWTNEDEPGLSVYEKSKLLAEKAAWDFVENENTIVEFATINPVAIFGPSLDAHVSGSFHLLENLLNGSMKRVPQIPLNVVDVRDVAELHILAMTNEQANGKRFIATADGQINLLEIAKLIKEKRPEIAQKVSTKKLPDFILSLGAKFNHQAKEGKLLLDMNRNVSNERAKTLLGWEPIATQEEAILAAIDSMAKFHLI

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SA0317 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]