Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0358 [new locus tag: SA_RS02045 ]
- pan locus tag?: SAUPAN001970000
- symbol: SA0358
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0358 [new locus tag: SA_RS02045 ]
- symbol: SA0358
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 416142..416510
- length: 369
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123138 NCBI
- RefSeq: NP_373605 NCBI
- BioCyc: see SA_RS02045
- MicrobesOnline: 102631 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361TTGAAAACGATTTTAAAAACAATAACATATCTTGCACTTACTATCATTGGCGCTTATGCT
GCTTTATTCATTTTAAAAACAATAGACTCTCATGGTATAACAGATCAATTTAACCCATTA
GTAAAGGAAGATGATTCTTATGTTAAAACGACAGAGGTGTCTACTAGAATGGATGATCAA
CTCCGAAGTTATACTCAAAGTGCTTTTAATAAAGAAGGGAAAGAGACGCAATTAATGTAT
ACTGCTACATTTGATGTTAAACCGCATAGATACTTGAAAATTACACATAAAGGTCATCAT
GTAGAAACTTTTGAAGAAGTTGAAAAGGAAGAAGTACCAAAGAAAGCATTAGACAAACTG
AGTCGATAA60
120
180
240
300
360
369
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0358 [new locus tag: SA_RS02045 ]
- symbol: SA0358
- description: hypothetical protein
- length: 122
- theoretical pI: 7.86831
- theoretical MW: 14084
- GRAVY: -0.513115
⊟Function[edit | edit source]
- TIGRFAM: Hypothetical proteins Conserved conserved hypothetical protein (TIGR01655; HMM-score: 63.5)
- TheSEED :
- FIG01108566: hypothetical protein
- PFAM: no clan defined DUF1093; Protein of unknown function (DUF1093) (PF06486; HMM-score: 58.4)and 2 moreTrigger_N; Bacterial trigger factor protein (TF) (PF05697; HMM-score: 14.4)Lipoprotein_10; Putative mycoplasma lipoprotein, C-terminal region (PF03202; HMM-score: 13.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 3.33
- Cellwall Score: 3.33
- Extracellular Score: 3.33
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.7268
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.2728
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: 0
- N-terminally Anchored Score: 4
- Predicted Cleavage Site: No CleavageSite
- SignalP: Signal peptide SP(Sec/SPI) length 32 aa
- SP(Sec/SPI): 0.522928
- TAT(Tat/SPI): 0.00227
- LIPO(Sec/SPII): 0.023409
- Cleavage Site: CS pos: 32-33. SHG-IT. Pr: 0.2744
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKTILKTITYLALTIIGAYAALFILKTIDSHGITDQFNPLVKEDDSYVKTTEVSTRMDDQLRSYTQSAFNKEGKETQLMYTATFDVKPHRYLKITHKGHHVETFEEVEKEEVPKKALDKLSR
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]