Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0904 [new locus tag: SA_RS05125 ]
- pan locus tag?: SAUPAN003258000
- symbol: SA0904
- pan gene symbol?: —
- synonym:
- product: ATL autolysin transcription regulator
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0904 [new locus tag: SA_RS05125 ]
- symbol: SA0904
- product: ATL autolysin transcription regulator
- replicon: chromosome
- strand: +
- coordinates: 1025716..1026135
- length: 420
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123727 NCBI
- RefSeq: NP_374171 NCBI
- BioCyc: see SA_RS05125
- MicrobesOnline: 103197 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAAACAACTTGAAAAACTTATTACACTGACTAACAATGACTTAAACTTAGTGAAT
AGAAGATTTGGACAACGCACGGATATCACATCTGAACAGCTAGAACTTCTCCGTATTTTA
TTTAATTACGATCGCTTATCACAGTATGATTTGACGATGAAGATTAGCAGGGAACAATCT
ATAGTTTCAAGGTGGATTAAGAAATTAGTTTTGAAAGGTTACATCACAAGTCAACAATCT
AGCGAAGATTTAAGATGTAAAGAATTAATTTTGACTGATCAAGCACGTACATTAATTTCA
CAAATAAATAATGCACGTTGCGAATTGATTGAAGCAAGATGTCAATGTTTATCGGAAGTC
GAATTAGACAATTTAAATCAATTACTTGATAAGTTAAATCAACGACGCATATCGTTGTAA60
120
180
240
300
360
420
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0904 [new locus tag: SA_RS05125 ]
- symbol: SA0904
- description: ATL autolysin transcription regulator
- length: 139
- theoretical pI: 8.62983
- theoretical MW: 16449.9
- GRAVY: -0.434532
⊟Function[edit | edit source]
- TIGRFAM: homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 30)and 2 moremobile rSAM pair MarR family regulator (TIGR04472; HMM-score: 19)Regulatory functions DNA interactions staphylococcal accessory regulator family (TIGR01889; HMM-score: 17.4)
- TheSEED :
- Putative ATL autolysin transcription regulator
- PFAM: HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 54.7)and 4 moreHTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 25.4)MarR_2; MarR family (PF12802; HMM-score: 22.1)Staph_reg_Sar_Rot; Transcriptional regulator SarA/Rot (PF22381; HMM-score: 20)TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 17.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9795
- Cytoplasmic Membrane Score: 0.0019
- Cell wall & surface Score: 0.0005
- Extracellular Score: 0.0181
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002753
- TAT(Tat/SPI): 0.000239
- LIPO(Sec/SPII): 0.000271
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYKQLEKLITLTNNDLNLVNRRFGQRTDITSEQLELLRILFNYDRLSQYDLTMKISREQSIVSRWIKKLVLKGYITSQQSSEDLRCKELILTDQARTLISQINNARCELIEARCQCLSEVELDNLNQLLDKLNQRRISL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.