Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2243 [new locus tag: SA_RS12885 ]
- pan locus tag?: SAUPAN006010000
- symbol: SA2243
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2243 [new locus tag: SA_RS12885 ]
- symbol: SA2243
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2520153..2520815
- length: 663
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1125170 NCBI
- RefSeq: NP_375566 NCBI
- BioCyc: see SA_RS12885
- MicrobesOnline: 104592 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGTTGTTAGAAATTAAAGATTTAGTGTATAAAGCGAGCGATAGAATCATACTAGATCAT
ATCAGTCTAAAAGTAGATAAAGGCGAGAGTATTGCCATTATAGGTCCATCAGGTAGTGGT
AAAAGTACATTTCAAAAGCAAATATGTAATTTGATTAGTCCAACTAGTGGAGAACTTTAT
TTTAAAGGTAAACCCTATAATGATTATGACCCGGAAGAATTGCGTCAACGAATCAGTTAT
TTGATGCAGCAAAGTGACTTGTTTGGTGAAACGATTGAAGATAACATGATATTCCCATCA
CTTGCACGTAATGATAAATTTGATAGAAAACGTGCAAAGCAATTAATTAAAGATGTCGGT
TTGGGACATTATCAATTAAGTTCGGAAGTGGAAAATATGTCGGGTGGTGAGCGGCAAAGA
ATTGCTATAGCGCGCCAACTGATGTATACACCGGATATTCTTTTATTAGATGAATCGACC
AGTGCATTAGACGTTAATAATAAAGAAAAGATAGAAAATATCATTTTTAAGTTAGTGGAA
CAGGATGTTGCTATCATGTGGATTACCCATAGTGATGATCAAAGTATGAGACATTTTCAA
AAGCGCATAACGATTGTTGATGGCAAAATTTCTAAGGTTGAGGAGTTGAATCAACATGAG
TAA60
120
180
240
300
360
420
480
540
600
660
663
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2243 [new locus tag: SA_RS12885 ]
- symbol: SA2243
- description: hypothetical protein
- length: 220
- theoretical pI: 5.40235
- theoretical MW: 25250.7
- GRAVY: -0.474091
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 137.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 137.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 136.8)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 136.8)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 133.9)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 131.4)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 129.8)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 128.7)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 128.5)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 125.9)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 125.8)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 123.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 123.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 123.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 121.9)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.6)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.6)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.4)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 117.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 116.6)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 115)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 114.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 113.5)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 112.1)and 48 moreProtein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 109.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 108)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 107.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 105.9)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 105.9)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 105.5)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 104.3)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 103.8)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 103.5)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 99.2)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 95.9)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95.7)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 94.5)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 91.6)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 91.6)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 90.5)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 89.9)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 88.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85.8)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 85.6)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 84.6)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 83.5)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 83.2)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 82.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 77.7)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 77.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 77.5)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 74.1)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 74)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 72)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 70)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 67.2)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 63.1)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 63.1)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 61.5)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 61.5)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 58.8)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 51.8)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 47.8)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 46.3)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 45.6)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 31.8)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 18.1)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 15.6)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 15.1)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 14.3)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 14.3)
- TheSEED :
- Probable iron export ATP-binding protein FetA
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 116.9)and 30 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 28.4)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 20.9)AAA_18; AAA domain (PF13238; HMM-score: 17.5)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 17.4)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 17.1)RNA_helicase; RNA helicase (PF00910; HMM-score: 16.3)AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.1)NACHT; NACHT domain (PF05729; HMM-score: 15.7)AAA_33; AAA domain (PF13671; HMM-score: 15.5)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 15.4)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.3)AAA_22; AAA domain (PF13401; HMM-score: 15.2)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 15)Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15)AAA_14; AAA domain (PF13173; HMM-score: 14.6)NB-ARC; NB-ARC domain (PF00931; HMM-score: 14.5)NTPase_1; NTPase (PF03266; HMM-score: 14.4)AAA_24; AAA domain (PF13479; HMM-score: 14.4)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 14.1)AAA_25; AAA domain (PF13481; HMM-score: 13.9)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.6)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 13.5)DO-GTPase1; Double-GTPase 1 (PF19975; HMM-score: 13.3)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.9)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 12.7)ABC_ATPase; P-loop domain (PF09818; HMM-score: 12)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 11.9)AAA_23; AAA domain (PF13476; HMM-score: 11.5)AAA_10; AAA-like domain (PF12846; HMM-score: 10.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.3438
- Cytoplasmic Membrane Score: 0.6204
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0357
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.012362
- TAT(Tat/SPI): 0.000636
- LIPO(Sec/SPII): 0.001616
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLLEIKDLVYKASDRIILDHISLKVDKGESIAIIGPSGSGKSTFQKQICNLISPTSGELYFKGKPYNDYDPEELRQRISYLMQQSDLFGETIEDNMIFPSLARNDKFDRKRAKQLIKDVGLGHYQLSSEVENMSGGERQRIAIARQLMYTPDILLLDESTSALDVNNKEKIENIIFKLVEQDVAIMWITHSDDQSMRHFQKRITIVDGKISKVEELNQHE
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]