From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2453 [new locus tag: SA_RS14050 ]
  • pan locus tag?: SAUPAN006405000
  • symbol: SA2453
  • pan gene symbol?: msrA3
  • synonym:
  • product: methionine sulfoxide reductase A

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2453 [new locus tag: SA_RS14050 ]
  • symbol: SA2453
  • product: methionine sulfoxide reductase A
  • replicon: chromosome
  • strand: -
  • coordinates: 2765575..2766051
  • length: 477
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGTAGTTGTTTATGTAGCAGGAGGGTGTCTATGGGGTGTTGAAGCATTTTTTGCAACA
    ATACCTGGAATTATACATACAGAAGCAGGAAGAGCAAATGGAAGAAGCTCTAAATTAGAC
    GGTCCGTATGATGGTTATGCTGAATGTGTCAAACTTCATTTCGATGATCGTATGTTAACA
    ATTACAGACATTATGAATTATTTATTTGAAATCATTGATCCTTACAGTGTGAATCAACAA
    GGAAATGATATTGGAGAAAAGTATCGAACGGGTTTATATAGTTGTGTAGATGACCACTTA
    ATTGAAGCGCGTCAGTTCATTGAACGACGTAAAGACAGAGATCAAATTGCAGTGGAAGTC
    TTACCGCTGTCTAACTACATTAAAAGTGCTGAAGAACATCAGCAACATTTAGAAAAATAT
    CCAGAAGATATGCATATGTGTCATATTTCAAAAGATTTGCTAAATAAATACAAGTGA
    60
    120
    180
    240
    300
    360
    420
    477

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2453 [new locus tag: SA_RS14050 ]
  • symbol: SA2453
  • description: methionine sulfoxide reductase A
  • length: 158
  • theoretical pI: 5.24881
  • theoretical MW: 18190.5
  • GRAVY: -0.396203

Function[edit | edit source]

  • reaction:
    EC 1.8.4.11?  ExPASy
    Peptide-methionine (S)-S-oxide reductase Peptide-L-methionine + thioredoxin disulfide + H2O = peptide-L-methionine (S)-S-oxide + thioredoxin L-methionine + thioredoxin disulfide + H2O = L-methionine (S)-S-oxide + thioredoxin
  • TIGRFAM:
    Cellular processes Cellular processes Adaptations to atypical conditions peptide-methionine (S)-S-oxide reductase (TIGR00401; EC 1.8.4.11; HMM-score: 97.9)
    Genetic information processing Protein fate Protein modification and repair peptide-methionine (S)-S-oxide reductase (TIGR00401; EC 1.8.4.11; HMM-score: 97.9)
  • TheSEED:  
    Protein Metabolism Protein processing and modification Peptide methionine sulfoxide reductase  Peptide methionine sulfoxide reductase MsrA (EC 1.8.4.11)
  • PFAM:
    no clan defined PMSR; Peptide methionine sulfoxide reductase (PF01625; HMM-score: 128.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helix: 1
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.83
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.395995
    • TAT(Tat/SPI): 0.013557
    • LIPO(Sec/SPII): 0.014432
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVVVYVAGGCLWGVEAFFATIPGIIHTEAGRANGRSSKLDGPYDGYAECVKLHFDDRMLTITDIMNYLFEIIDPYSVNQQGNDIGEKYRTGLYSCVDDHLIEARQFIERRKDRDQIAVEVLPLSNYIKSAEEHQQHLEKYPEDMHMCHISKDLLNKYK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Seoung Min Bong, Geun-Hee Kwak, Jin Ho Moon, Ki Seog Lee, Hong Seok Kim, Hwa-Young Kim, Young Min Chi
Structural and kinetic analysis of free methionine-R-sulfoxide reductase from Staphylococcus aureus: conformational changes during catalysis and implications for the catalytic and inhibitory mechanisms.
J Biol Chem: 2010, 285(32);25044-52
[PubMed:20504774] [WorldCat.org] [DOI] (I p)