From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0106 [new locus tag: SACOL_RS00525 ]
  • pan locus tag?: SAUPAN000921000
  • symbol: SACOL0106
  • pan gene symbol?: sbnG
  • synonym:
  • product: HPCH/HPAI aldolase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0106 [new locus tag: SACOL_RS00525 ]
  • symbol: SACOL0106
  • product: HPCH/HPAI aldolase
  • replicon: chromosome
  • strand: +
  • coordinates: 122132..122908
  • length: 777
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGCAACAACTATCTCTGAAACATAGATTAAACAATGGTGATTCAGTTTATGGCATTTTT
    AATTCTATACCGGACCCATTGATGATCGAGGTTATCGCAGCAAGCGGGTATGACTTTGTT
    GTGATTGATACAGAACACGTGGCGATTAATGATGAGACACTAGCGCATTTAATTCGTGCA
    GCTGAAGCAGCGCATATTATACCAATTGTACGTGTCACTGCAGTGATAGATAGAGATATC
    ATTAAAGTGTTGGATATGGGTGCGAGAGGTATTATTGTGCCACACGTTAAAGATCGTGAG
    ACAGTTGAGCATATTGTGAAATTAAGTCGTTATTACCCGCAAGGATTAAGAAGTTTGAAT
    GGTGGTCGCATGGCAAGATTTGGACGTACACCATTACTTGATGCAATGGAGATGGCTAAT
    GAGCATATTATGGTGATTGCCATGATAGAAGATGTTGAAGGGGTTATGGCCATTGACGAT
    ATAGCACAAGTCGAAGGTTTAGACATGATAGTCGAAGGTGCCGCAGATTTATCGCAGTCA
    CTTGGCATACCATGGCAAACGCGTGATGATCAAGTAACATCACATGTTCAACATATTTTT
    GAAGTTGTGAATGCACATGGTAAACATTTTTGTGCATTACCACGTGAAGATGAAGATATT
    GCAAAATGGCAGGCACAAGGTGTACAAACATTTATTTTAGGTGATGATCGCGGAAAAATA
    TATCGCCATTTAAGTGCATCTCTAGCGACGTCTAAACAGAAAGGGGATGAAGGCTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    777

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0106 [new locus tag: SACOL_RS00525 ]
  • symbol: SACOL0106
  • description: HPCH/HPAI aldolase
  • length: 258
  • theoretical pI: 5.14904
  • theoretical MW: 28587.5
  • GRAVY: -0.0515504

Function[edit | edit source]

  • TIGRFAM:
    2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase (TIGR02311; EC 4.1.2.-; HMM-score: 131.9)
    2-dehydro-3-deoxyglucarate aldolase (TIGR03239; EC 4.1.2.20; HMM-score: 121.5)
  • TheSEED:  
    Iron acquisition and metabolism Siderophores Siderophore Staphylobactin  Siderophore staphylobactin biosynthesis protein SbnG
  • PFAM:
    PK_TIM (CL0151) HpcH_HpaI; HpcH/HpaI aldolase/citrate lyase family (PF03328; HMM-score: 105.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00354
    • TAT(Tat/SPI): 0.000169
    • LIPO(Sec/SPII): 0.000372
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQQLSLKHRLNNGDSVYGIFNSIPDPLMIEVIAASGYDFVVIDTEHVAINDETLAHLIRAAEAAHIIPIVRVTAVIDRDIIKVLDMGARGIIVPHVKDRETVEHIVKLSRYYPQGLRSLNGGRMARFGRTPLLDAMEMANEHIMVIAMIEDVEGVMAIDDIAQVEGLDMIVEGAADLSQSLGIPWQTRDDQVTSHVQHIFEVVNAHGKHFCALPREDEDIAKWQAQGVQTFILGDDRGKIYRHLSASLATSKQKGDEG

Experimental data[edit | edit source]

  • experimental localization: Cytoplasmic [1]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: Fur* (repression) regulon
    Fur(TF)important in Iron homeostasis; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Suzanne E Dale, Amanda Doherty-Kirby, Gilles Lajoie, David E Heinrichs
Role of siderophore biosynthesis in virulence of Staphylococcus aureus: identification and characterization of genes involved in production of a siderophore.
Infect Immun: 2004, 72(1);29-37
[PubMed:14688077] [WorldCat.org] [DOI] (P p)