⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
- pan locus tag?: SAUPAN002873000
- symbol: seb
- pan gene symbol?: seb
- synonym:
- product: enterotoxin B
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
- symbol: seb
- product: enterotoxin B
- replicon: chromosome
- strand: +
- coordinates: 916478..917278
- length: 801
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3237776 NCBI
- RefSeq: YP_185778 NCBI
- BioCyc: see SACOL_RS04655
- MicrobesOnline: 912378 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781ATGTATAAGAGATTATTTATTTCACATGTAATTTTGATATTCGCACTGATATTAGTTATT
TCTACACCCAACGTTTTAGCAGAGAGTCAACCAGATCCTAAACCAGATGAGTTGCACAAA
TCGAGTAAATTCACTGGTTTGATGGAAAATATGAAAGTTTTGTATGATGATAATCATGTA
TCAGCAATAAACGTTAAATCTATAGATCAATTTCTATACTTTGACTTAATATATTCTATT
AAGGACACTAAGTTAGGGAATTATGATAATGTTCGAGTCGAATTTAAAAACAAAGATTTA
GCTGATAAATACAAAGATAAATACGTAGATGTGTTTGGAGCTAATTATTATTATCAATGT
TATTTTTCTAAAAAAACGAATGATATTAATTCGCATCAAACTGACAAACGAAAAACTTGT
ATGTATGGTGGTGTAACTGAGCATAATGGAAACCAATTAGATAAATATAGAAGTATTACT
GTTCGGGTATTTGAAGATGGTAAAAATTTATTATCTTTTGACGTACAAACTAATAAGAAA
AAGGTGACTGCTCAAGAATTAGATTACCTAACTCGTCACTATTTGGTGAAAAATAAAAAA
CTCTATGAATTTAACAACTCGCCTTATGAAACGGGATATATTAAATTTATAGAAAATGAG
AATAGCTTTTGGTATGACATGATGCCTGCACCAGGAGATAAATTTGACCAATCTAAATAT
TTAATGATGTACAATGACAATAAAATGGTTGATTCTAAAGATGTGAAGATTGAAGTTTAT
CTTACGACAAAGAAAAAGTGA60
120
180
240
300
360
420
480
540
600
660
720
780
801
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
- symbol: Seb
- description: enterotoxin B
- length: 266
- theoretical pI: 8.93645
- theoretical MW: 31435.7
- GRAVY: -0.664286
⊟Function[edit | edit source]
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Extracellular
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0
- Extracellular Score: 10
- Internal Helix: 1
- LocateP: Secretory(released) (with CS)
- Prediction by SwissProt Classification: Extracellular
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: 1
- N-terminally Anchored Score: -2
- Predicted Cleavage Site: PNVLAESQ
- SignalP: Signal peptide SP(Sec/SPI) length 27 aa
- SP(Sec/SPI): 0.996706
- TAT(Tat/SPI): 0.001009
- LIPO(Sec/SPII): 0.001256
- Cleavage Site: CS pos: 27-28. VLA-ES. Pr: 0.9402
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYKRLFISHVILIFALILVISTPNVLAESQPDPKPDELHKSSKFTGLMENMKVLYDDNHVSAINVKSIDQFLYFDLIYSIKDTKLGNYDNVRVEFKNKDLADKYKDKYVDVFGANYYYQCYFSKKTNDINSHQTDKRKTCMYGGVTEHNGNQLDKYRSITVRVFEDGKNLLSFDVQTNKKKVTAQELDYLTRHYLVKNKKLYEFNNSPYETGYIKFIENENSFWYDMMPAPGDKFDQSKYLMMYNDNKMVDSKDVKIEVYLTTKKK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Signal peptide containing [1] [2] [3] [4]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Y Jie, Z Pan, Y Chen, Y Wei, W Zhang, L Xu, Y Wu, H Peng
SEB combined with IL-1ra could prolong the survival of the rat allografts in high-risk corneal transplantation.
Transplant Proc: 2004, 36(10);3267-71
[PubMed:15686743] [WorldCat.org] [DOI] (P p)Carles Garriga, Anna Pérez-Bosque, Concepció Amat, Joy M Campbell, Louis Russell, Javier Polo, Joana M Planas, Miquel Moretó
Spray-dried porcine plasma reduces the effects of staphylococcal enterotoxin B on glucose transport in rat intestine.
J Nutr: 2005, 135(7);1653-8
[PubMed:15987845] [WorldCat.org] [DOI] (P p)Govindarajan Rajagopalan, Koji Iijima, Manisha Singh, Hirohito Kita, Robin Patel, Chella S David
Intranasal exposure to bacterial superantigens induces airway inflammation in HLA class II transgenic mice.
Infect Immun: 2006, 74(2);1284-96
[PubMed:16428778] [WorldCat.org] [DOI] (P p)Akiko Miyata, Masaru Natsuaki, Kiyofumi Yamanishi
Staphylococcal enterotoxin B enhances a flare-up reaction of murine contact hypersensitivity through up-regulation of interferon-gamma.
Exp Dermatol: 2008, 17(10);843-8
[PubMed:18341571] [WorldCat.org] [DOI] (I p)Thibaut Van Zele, Mario Vaneechoutte, Gabriele Holtappels, Philippe Gevaert, P van Cauwenberge, Claus Bachert
Detection of enterotoxin DNA in Staphylococcus aureus strains obtained from the middle meatus in controls and nasal polyp patients.
Am J Rhinol: 2008, 22(3);223-7
[PubMed:18588752] [WorldCat.org] [DOI] (P p)W Huvenne, I Callebaut, K Reekmans, G Hens, S Bobic, M Jorissen, D M A Bullens, J L Ceuppens, C Bachert, P W Hellings
Staphylococcus aureus enterotoxin B augments granulocyte migration and survival via airway epithelial cell activation.
Allergy: 2010, 65(8);1013-20
[PubMed:20132156] [WorldCat.org] [DOI] (I p)Jiazhang Qiu, Dacheng Wang, Hua Xiang, Haihua Feng, Youshuai Jiang, Lijie Xia, Jing Dong, Jing Lu, Lu Yu, Xuming Deng
Subinhibitory concentrations of thymol reduce enterotoxins A and B and alpha-hemolysin production in Staphylococcus aureus isolates.
PLoS One: 2010, 5(3);e9736
[PubMed:20305813] [WorldCat.org] [DOI] (I e)David E Kearney, Wei Wang, H Paul Redmond, Jiang Huai Wang
Bacterial superantigens enhance the in vitro proinflammatory response and in vivo lethality of the TLR2 agonist bacterial lipoprotein.
J Immunol: 2011, 187(10);5363-9
[PubMed:22003201] [WorldCat.org] [DOI] (I p)Monica A McArthur, Marcelo B Sztein
Unexpected heterogeneity of multifunctional T cells in response to superantigen stimulation in humans.
Clin Immunol: 2013, 146(2);140-52
[PubMed:23333555] [WorldCat.org] [DOI] (I p)Liwei Gu, Junjie Yue, Yuling Zheng, Xin Zheng, Jun Wang, Yanzi Wang, Jianchun Li, Yongqiang Jiang, Hua Jiang
Evaluation of a recombinant double mutant of staphylococcal enterotoxin B (SEB-H32Q/K173E) with enhanced antitumor activity effects and decreased pyrexia.
PLoS One: 2013, 8(2);e55892
[PubMed:23405232] [WorldCat.org] [DOI] (I p)