From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1787 [new locus tag: SACOL_RS09155 ]
  • pan locus tag?: SAUPAN004402000
  • symbol: SACOL1787
  • pan gene symbol?: aroA2
  • synonym:
  • product: bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1787 [new locus tag: SACOL_RS09155 ]
  • symbol: SACOL1787
  • product: bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
  • replicon: chromosome
  • strand: -
  • coordinates: 1831834..1832925
  • length: 1092
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAGTAATAAATTAGAATCATACAGAAGTGAGATTGTATCACTGAATCATCAAATTTTA
    GACTTATTATCTAAACGTGGTGAACTAGCACAAAAAATTGGGGAAGAAAAATTAAAACAA
    GGTACACGTATTTATGATCCACAACGTGAAAAAGAAATGCTTAACGACTTAATCGATAGT
    AACAAAGGACCATTCAACGATAATACTATTAAGCAATTATTTAAAGAAATTTTCAAAGCC
    TCTACAGATTTACAAAAATCTGAAAATGAAAAACATTTATATGTATCACGTAAGTTGAAA
    CCTGAAGATACGATTGTAACATTTGATAATGGGGGCATTATTGGAGACGGCAATAAATCA
    TTTGTATTTGGGCCATGTTCAGTTGAATCATTTGAACAAGTTGAAGCTGTTGCTAAAAAC
    TTACATGCTAAAGGTGAAAAATTTATTCGTGGCGGTGCATTTAAACCACGTACATCACCA
    TATGATTTCCAAGGCCTAGGTGTTGAAGGACTTAAAATACTTAAACAGATTAAAGATAAA
    TATGATTTAAATGTTGTCAGCGAAATCGTAAATCCAAATGATTTTGAAGTGGCTGATGAG
    TATTTAGACGTATTCCAAATTGGTGCACGTAATATGCAAAACTTCGAGTTATTAAAAGAA
    GCTGGCCGTACGAAAAAGCCTATTCTATTAAAACGTGGTTTATCTGCTACAATCGAAGAG
    TTTGTTTATGCAGCTGAATACATTGCTTCACAAGGTAATCAAAACATTATTTTATGTGAA
    CGTGGAATCCGAACTTATGAAAAGGCGACACGTAACACTTTAGATATTTCAGCAGTACCA
    ATTTTAAAACAAGGTACACACTTACCAGTCATGGTAGATGTTACGCATAGTACAGGTCGT
    AAAGATATCATGTTACCAACTGCGAAAGCAGCATTAGCAGTTGGTGCTGATGGAGTTATG
    GCTGAGGTGCATCCAGATCCATCTGTTGCACTTAGTGATGCGGGTCAACAAATGGATTTA
    GATGAATTCCAAGCATTTTATGATGAATTAAAGCCTTTAGCTGATTTATATAACGCTAAA
    AAGTTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1092

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1787 [new locus tag: SACOL_RS09155 ]
  • symbol: SACOL1787
  • description: bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
  • length: 363
  • theoretical pI: 6.02863
  • theoretical MW: 40618
  • GRAVY: -0.44022

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Amino acid biosynthesis Aromatic amino acid family 3-deoxy-7-phosphoheptulonate synthase (TIGR01361; EC 2.5.1.54; HMM-score: 381.7)
    and 11 more
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01801; EC 5.4.99.5; HMM-score: 170.2)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides 3-deoxy-8-phosphooctulonate synthase (TIGR01362; EC 2.5.1.55; HMM-score: 121.6)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01807; EC 5.4.99.5; HMM-score: 64.4)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01791; EC 5.4.99.5; HMM-score: 53.5)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01805; EC 5.4.99.5; HMM-score: 45.9)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01797; EC 5.4.99.5; HMM-score: 36.2)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01799; EC 5.4.99.5; HMM-score: 36.2)
    Metabolism Amino acid biosynthesis Aromatic amino acid family chorismate mutase (TIGR01808; EC 5.4.99.5; HMM-score: 35.4)
    pseudaminic acid synthase (TIGR03586; EC 2.5.1.97; HMM-score: 28.5)
    Metabolism Amino acid biosynthesis Aromatic amino acid family putative chorismate mutase (TIGR01806; EC 5.4.99.5; HMM-score: 28.3)
    N-acetylneuraminate synthase (TIGR03569; EC 2.5.1.56; HMM-score: 18.3)
  • TheSEED:  
    Amino Acids and Derivatives Aromatic amino acids and derivatives Chorismate Synthesis  2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I beta (EC 2.5.1.54)
    and 4 more
    Chorismate mutase I (EC 5.4.99.5)
    Common Pathway For Synthesis of Aromatic Compounds (DAHP synthase to chorismate)  2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I beta (EC 2.5.1.54)
    Phenylalanine and Tyrosine Branches from Chorismate  Chorismate mutase I (EC 5.4.99.5)
    Miscellaneous Plant-Prokaryote comparative genomics Omega-amidase KE2  2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I beta (EC 2.5.1.54)
  • PFAM:
    TIM_barrel (CL0036) DAHP_synth_1; DAHP synthetase I family (PF00793; HMM-score: 287.3)
    and 3 more
    no clan defined CM_2; Chorismate mutase type II (PF01817; HMM-score: 74.1)
    TIM_barrel (CL0036) NeuB; NeuB family (PF03102; HMM-score: 32.7)
    no clan defined SPOB_ab; Sporulation initiation phospho-transferase B, C-terminal (PF14682; HMM-score: 15.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005725
    • TAT(Tat/SPI): 0.000718
    • LIPO(Sec/SPII): 0.000643
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSNKLESYRSEIVSLNHQILDLLSKRGELAQKIGEEKLKQGTRIYDPQREKEMLNDLIDSNKGPFNDNTIKQLFKEIFKASTDLQKSENEKHLYVSRKLKPEDTIVTFDNGGIIGDGNKSFVFGPCSVESFEQVEAVAKNLHAKGEKFIRGGAFKPRTSPYDFQGLGVEGLKILKQIKDKYDLNVVSEIVNPNDFEVADEYLDVFQIGARNMQNFELLKEAGRTKKPILLKRGLSATIEEFVYAAEYIASQGNQNIILCERGIRTYEKATRNTLDISAVPILKQGTHLPVMVDVTHSTGRKDIMLPTAKAALAVGADGVMAEVHPDPSVALSDAGQQMDLDEFQAFYDELKPLADLYNAKKLK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3] [4]
    quantitative data / protein copy number per cell: 4411 [5]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SACOL1787 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 49.16 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]