Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS01820 [old locus tag: SACOL0362 ]
- pan locus tag?: SAUPAN001577000
- symbol: SACOL_RS01820
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS01820 [old locus tag: SACOL0362 ]
- symbol: SACOL_RS01820
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 372375..372575
- length: 201
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (372375..372575) NCBI
- BioCyc: SACOL_RS01820 BioCyc
- MicrobesOnline: see SACOL0362
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGTGGATTGTCATTTCAATTGTTTTATCTATATTTTTATTGATCTTGTTAAGTAGCATT
TCTCATAAGATGAAAACCATAGAAGCATTGGAGTATATGAATGCTTATCTTTTCAAGCAG
TTAGTAAAAAATAATGGTGTTGAAGGTTTAGAAGATTATGAAAATGAAGTTGAACGAATT
AGAAAAAGATTCAAAAGCTAA60
120
180
201
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS01820 [old locus tag: SACOL0362 ]
- symbol: SACOL_RS01820
- description: hypothetical protein
- length: 66
- theoretical pI: 8.97623
- theoretical MW: 7806.21
- GRAVY: 0.184848
⊟Function[edit | edit source]
- TIGRFAM: type II secretion system protein I (TIGR01707; HMM-score: 12.6)
- TheSEED: see SACOL0362
- PFAM: no clan defined DUF1514; Protein of unknown function (DUF1514) (PF07438; HMM-score: 133.5)and 1 moreComm; Commissureless (PF15957; HMM-score: 8.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0013
- Cytoplasmic Membrane Score: 0.7182
- Cell wall & surface Score: 0.0015
- Extracellular Score: 0.279
- LocateP:
- SignalP: Signal peptide SP(Sec/SPI) length 29 aa
- SP(Sec/SPI): 0.529099
- TAT(Tat/SPI): 0.00246
- LIPO(Sec/SPII): 0.191734
- Cleavage Site: CS pos: 29-30. IEA-LE. Pr: 0.4704
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MWIVISIVLSIFLLILLSSISHKMKTIEALEYMNAYLFKQLVKNNGVEGLEDYENEVERIRKRFKS
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]