From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03455 [old locus tag: SACOL0668 ]
  • pan locus tag?: SAUPAN002479000
  • symbol: SACOL_RS03455
  • pan gene symbol?:
  • synonym:
  • product: alpha/beta hydrolase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS03455 [old locus tag: SACOL0668 ]
  • symbol: SACOL_RS03455
  • product: alpha/beta hydrolase
  • replicon: chromosome
  • strand: +
  • coordinates: 696448..697248
  • length: 801
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (696448..697248) NCBI
  • BioCyc: G1G4B-720 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGATCTATTTACTAGAAAAGATGGAACATCGATACATTACAGTACATTAGGTGAAGGC
    TATCCTATCGTATTGATTCATACTGTACTTGATAATTATTCTGTGTTTAATAAATTAGCA
    GCAGAATTAGCAAAATCATTTCAAGTTGTGTTAATTGATTTACGTGGACATGGCTATTCT
    GATAAACCTCGTCACATTGAAATAAAAGATTTTTCTGATGACATTGTTGAATTACTTAAA
    TATTTATATATTGAAGAAGTTGCATTTGTATGCCATGAAATGGGTGGAATCATTGGTGCG
    GATATTTCAGTACGTTATCCTGAATTTACATCATCACTTACGTTGGTAAATCCAACATCT
    ATTGAAGGTGAATTACCGGAAGAACGTTTATTTAGAAAATATGCCCATATTATTCGAAAC
    TGGGATCCTGAAAAACAAGATAAATTTTTAAATAAGCGTAAGTATTATCGTCCGAGAAAA
    ATGAATCGATTCCTCAAACATGTCGTAGATACAAATGAAATATCAACTAAAGAAGAAATT
    CAAGCAGTTAAAGAGGTATTCAAAAACGCTGATATTTCTCAAACTTATAGAAATGTCGTA
    GTACCGACAAAAATTATTGCAGGAGAATTCGGTGAAAGAACAACAAGATTAGAAGCTAAA
    GAAGTAGCTGATTTAATCCAAAATGCGGACTTTGAAGTATATCAAGAATCAAGTGCATTC
    CCATTTGTTGAAGAGCAAGAAAGATTCGTCGAAGATACAGCTGCATTTATCAACAAACAT
    CACGATGAAAAGCATGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS03455 [old locus tag: SACOL0668 ]
  • symbol: SACOL_RS03455
  • description: alpha/beta hydrolase
  • length: 266
  • theoretical pI: 5.61604
  • theoretical MW: 30924.8
  • GRAVY: -0.433083

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Other 3-oxoadipate enol-lactonase (TIGR02427; EC 3.1.1.24; HMM-score: 82.2)
    and 7 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin pimelyl-[acyl-carrier protein] methyl ester esterase (TIGR01738; EC 3.1.1.85; HMM-score: 57.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 51.1)
    proline-specific peptidase (TIGR01250; HMM-score: 51)
    pyrimidine utilization protein D (TIGR03611; HMM-score: 42.5)
    Metabolism Energy metabolism Photosynthesis putative magnesium chelatase accessory protein (TIGR03056; HMM-score: 33)
    2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase (TIGR03343; EC 3.7.1.-; HMM-score: 20.5)
    Metabolism Energy metabolism Other poly(3-hydroxyalkanoate) depolymerase (TIGR02240; EC 3.1.1.-; HMM-score: 11.2)
  • TheSEED:
  • PFAM:
    AB_hydrolase (CL0028) Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 54.6)
    Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 46)
    and 5 more
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 35.5)
    Thioesterase; Thioesterase domain (PF00975; HMM-score: 14.2)
    Ndr; Ndr family (PF03096; HMM-score: 13.1)
    PDDEXK (CL0236) RE_HindIII; HindIII restriction endonuclease (PF09518; HMM-score: 12.8)
    PUP (CL0408) POC1; POC1 chaperone (PF10450; HMM-score: 12.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003127
    • TAT(Tat/SPI): 0.000249
    • LIPO(Sec/SPII): 0.000367
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446285112 NCBI
  • RefSeq: WP_000362967 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MDLFTRKDGTSIHYSTLGEGYPIVLIHTVLDNYSVFNKLAAELAKSFQVVLIDLRGHGYSDKPRHIEIKDFSDDIVELLKYLYIEEVAFVCHEMGGIIGADISVRYPEFTSSLTLVNPTSIEGELPEERLFRKYAHIIRNWDPEKQDKFLNKRKYYRPRKMNRFLKHVVDTNEISTKEEIQAVKEVFKNADISQTYRNVVVPTKIIAGEFGERTTRLEAKEVADLIQNADFEVYQESSAFPFVEEQERFVEDTAAFINKHHDEKHV

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]