From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05185 [old locus tag: SACOL1016 ]
  • pan locus tag?: SAUPAN003184000
  • symbol: SACOL_RS05185
  • pan gene symbol?: fabI
  • synonym:
  • product: enoyl-ACP reductase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS05185 [old locus tag: SACOL1016 ]
  • symbol: SACOL_RS05185
  • product: enoyl-ACP reductase
  • replicon: chromosome
  • strand: +
  • coordinates: 1023641..1024411
  • length: 771
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1023641..1024411) NCBI
  • BioCyc: G1G4B-1097 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTTAAATCTTGAAAACAAAACATATGTCATCATGGGAATCGCTAATAAGCGTAGTATT
    GCTTTTGGTGTCGCTAAAGTTTTAGATCAATTAGGTGCTAAATTAGTATTTACTTACCGT
    AAAGAACGTAGCCGTAAAGAGCTTGAAAAATTATTAGAACAATTAAATCAACCAGAAGCG
    CACTTATATCAAATTGATGTTCAAAGCGATGAAGAGGTTATTAATGGTTTTGAGCAAATT
    GGTAAAGATGTTGGCAATATTGATGGTGTATATCATTCAATCGCATTTGCTAATATGGAA
    GACTTACGCGGACGCTTTTCTGAAACTTCACGTGAAGGCTTCTTGTTAGCTCAAGACATT
    AGTTCTTACTCATTAACAATTGTGGCTCATGAAGCTAAAAAATTAATGCCAGAAGGTGGT
    AGCATTGTTGCAACAACATATTTAGGTGGCGAATTCGCAGTTCAAAACTATAATGTGATG
    GGTGTTGCTAAAGCGAGCTTAGAAGCAAATGTTAAATATTTAGCATTAGACTTAGGTCCA
    GATAATATTCGCGTTAATGCAATTTCAGCTGGTCCAATCCGTACATTAAGTGCAAAAGGT
    GTGGGTGGTTTCAATACAATTCTTAAAGAAATCGAAGAGCGTGCACCTTTAAAACGTAAT
    GTTGATCAAGTAGAAGTAGGTAAAACTGCGGCTTACTTATTAAGTGATTTATCAAGTGGC
    GTTACAGGTGAAAATATTCATGTAGATAGCGGATTCCACGCAATTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771

Protein[edit | edit source]

Protein Data Bank: 4ALI
Protein Data Bank: 4ALJ
Protein Data Bank: 4ALK
Protein Data Bank: 4ALL
Protein Data Bank: 4ALM
Protein Data Bank: 4ALN
Protein Data Bank: 4BNF
Protein Data Bank: 4BNG
Protein Data Bank: 4BNH
Protein Data Bank: 4BNI
Protein Data Bank: 4BNJ
Protein Data Bank: 4BNK
Protein Data Bank: 4BNL
Protein Data Bank: 4BNM
Protein Data Bank: 4BNN
Protein Data Bank: 4CUZ
Protein Data Bank: 4CV0
Protein Data Bank: 4CV1
Protein Data Bank: 4NZ9

General[edit | edit source]

  • locus tag: SACOL_RS05185 [old locus tag: SACOL1016 ]
  • symbol: SACOL_RS05185
  • description: enoyl-ACP reductase
  • length: 256
  • theoretical pI: 5.70808
  • theoretical MW: 27991.7
  • GRAVY: -0.143359

Function[edit | edit source]

  • reaction:
    EC 1.3.1.10?  ExPASy
    Enoyl-[acyl-carrier-protein] reductase (NADPH, Si-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPH
    EC 1.3.1.39?  ExPASy
    Enoyl-[acyl-carrier-protein] reductase (NADPH, Re-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPH
  • TIGRFAM:
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 67.7)
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 59)
    and 9 more
    rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 51.4)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 51.2)
    Metabolism Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 43.1)
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 42)
    2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 41.3)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 40.7)
    Metabolism Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 36.4)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis putative 3-oxoacyl-(acyl-carrier-protein) reductase (TIGR01831; HMM-score: 34)
    pteridine reductase (TIGR02685; EC 1.5.1.33; HMM-score: 32.5)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) adh_short_C2; Enoyl-(Acyl carrier protein) reductase (PF13561; HMM-score: 270.7)
    and 2 more
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 68.8)
    KR; KR domain (PF08659; HMM-score: 22.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS03050DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL_RS03755LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL_RS13415hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002447
    • TAT(Tat/SPI): 0.000352
    • LIPO(Sec/SPII): 0.0005
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446855939 NCBI
  • RefSeq: WP_000933195 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MLNLENKTYVIMGIANKRSIAFGVAKVLDQLGAKLVFTYRKERSRKELEKLLEQLNQPEAHLYQIDVQSDEEVINGFEQIGKDVGNIDGVYHSIAFANMEDLRGRFSETSREGFLLAQDISSYSLTIVAHEAKKLMPEGGSIVATTYLGGEFAVQNYNVMGVAKASLEANVKYLALDLGPDNIRVNAISAGPIRTLSAKGVGGFNTILKEIEERAPLKRNVDQVEVGKTAAYLLSDLSSGVTGENIHVDSGFHAIK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]