From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05930 [old locus tag: SACOL1161 ]
  • pan locus tag?: SAUPAN003390000
  • symbol: SACOL_RS05930
  • pan gene symbol?: murI
  • synonym:
  • product: glutamate racemase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS05930 [old locus tag: SACOL1161 ]
  • symbol: SACOL_RS05930
  • product: glutamate racemase
  • replicon: chromosome
  • strand: +
  • coordinates: 1171814..1172614
  • length: 801
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1171814..1172614) NCBI
  • BioCyc: G1G4B-1255 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAATAAACCAATAGGTGTAATAGACTCTGGTGTCGGAGGTTTGACAGTAGCTAAAGAA
    ATTATGCGTCAGTTGCCAAATGAGACGATTTATTACTTAGGTGATATTGGACGATGTCCA
    TATGGGCCAAGACCAGGAGAACAAGTAAAACAATATACAGTTGAAATCGCTCGTAAATTA
    ATGGAATTTGATATAAAAATGCTCGTGATTGCTTGTAATACAGCAACTGCTGTAGCTTTA
    GAATATTTACAAAAGACCTTATCAATCCCAGTGATTGGCGTAATTGAACCAGGTGCTAGA
    ACAGCAATAATGACTACTAGAAATCAAAATGTATTAGTACTAGGAACGGAAGGCACAATT
    AAATCTGAAGCATATCGTACGCATATTAAACGTATCAATCCACATGTAGAGGTACATGGC
    GTTGCCTGTCCAGGTTTTGTGCCACTTGTAGAACAAATGAGATATAGTGATCCAACAATT
    ACAAGCATTGTCATTCATCAAACACTGAAACGTTGGCGTAATAGTGAGTCTGATACTGTC
    ATTTTAGGATGTACCCACTATCCATTGCTCTATAAACCTATCTATGATTATTTTGGTGGT
    AAAAAGACAGTGATTTCGTCTGGATTAGAAACGGCTCGTGAAGTTAGTGCATTGCTAACA
    TTTAGTAATGAACATGCAAGTTATACTGAACATCCAGATCATCGATTTTTTGCAACAGGT
    GATCCTACTCACATTACTAACATTATCAAAGAGTGGTTAAATTTATCTGTCAATGTGGAA
    CGTATATCAGTGAATGACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS05930 [old locus tag: SACOL1161 ]
  • symbol: SACOL_RS05930
  • description: glutamate racemase
  • length: 266
  • theoretical pI: 7.63246
  • theoretical MW: 29698
  • GRAVY: -0.120301

Function[edit | edit source]

  • reaction:
    EC 5.1.1.3?  ExPASy
    Glutamate racemase L-glutamate = D-glutamate
  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glutamate racemase (TIGR00067; EC 5.1.1.3; HMM-score: 271.7)
    and 2 more
    Metabolism Energy metabolism Amino acids and amines aspartate racemase (TIGR00035; EC 5.1.1.13; HMM-score: 51.1)
    Cellular processes Cellular processes Cell division septum site-determining protein MinD (TIGR01968; HMM-score: 12.9)
  • TheSEED:
  • PFAM:
    Asp-glut_race (CL0399) Asp_Glu_race; Asp/Glu/Hydantoin racemase (PF01177; HMM-score: 117.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.013508
    • TAT(Tat/SPI): 0.000517
    • LIPO(Sec/SPII): 0.003397
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446962403 NCBI
  • RefSeq: WP_001039659 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MNKPIGVIDSGVGGLTVAKEIMRQLPNETIYYLGDIGRCPYGPRPGEQVKQYTVEIARKLMEFDIKMLVIACNTATAVALEYLQKTLSIPVIGVIEPGARTAIMTTRNQNVLVLGTEGTIKSEAYRTHIKRINPHVEVHGVACPGFVPLVEQMRYSDPTITSIVIHQTLKRWRNSESDTVILGCTHYPLLYKPIYDYFGGKKTVISSGLETAREVSALLTFSNEHASYTEHPDHRFFATGDPTHITNIIKEWLNLSVNVERISVND

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]