Jump to navigation
Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS14935
- pan locus tag?:
- symbol: SACOL_RS14935
- pan gene symbol?: —
- synonym:
- product: short-chain dehydrogenase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS14935
- symbol: SACOL_RS14935
- product: short-chain dehydrogenase
- replicon: chromosome
- strand: -
- coordinates: 2538980..2539066
- length: 87
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (2538980..2539066) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61ATGAAACGTTTGGAAAATAAAGTAGCAGTCGTAACAGGAGCAAGTACAGGTATCGGTCAA
GCTTCTGCAATCGCTTTAGCTCAATAA60
87
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS14935
- symbol: SACOL_RS14935
- description: short-chain dehydrogenase
- length: 28
- theoretical pI: 10.789
- theoretical MW: 2785.24
- GRAVY: 0.407143
⊟Function[edit | edit source]
- TIGRFAM: Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 25.1)Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 23.9)and 8 moreUnknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 16.7)3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 16.4)rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 16.1)Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 13.8)2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 13.8)Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 13.3)sepiapterin reductase (TIGR01500; EC 1.1.1.153; HMM-score: 13.2)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll light-dependent protochlorophyllide reductase (TIGR01289; EC 1.3.1.33; HMM-score: 12.1)
- TheSEED:
- PFAM: NADP_Rossmann (CL0063) Eno-Rase_NADH_b; NAD(P)H binding domain of trans-2-enoyl-CoA reductase (PF12242; HMM-score: 20)adh_short; short chain dehydrogenase (PF00106; HMM-score: 19.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.402791
- TAT(Tat/SPI): 0.068103
- LIPO(Sec/SPII): 0.117247
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000824926 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MKRLENKVAVVTGASTGIGQASAIALAQ
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.