Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_Sa5SB [new locus tag: SACOL_RS02905 ]
- pan locus tag?: SAUPAN002262000
- symbol: rrfB
- pan gene symbol?: rrf
- synonym:
- product: 5S ribosomal RNA
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: rRNA
- locus tag: SACOL_Sa5SB [new locus tag: SACOL_RS02905 ]
- symbol: rrfB
- product: 5S ribosomal RNA
- replicon: chromosome
- strand: +
- coordinates: 577662..577776
- length: 115
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3236458 NCBI
- RefSeq:
- BioCyc: see SACOL_RS02905
- MicrobesOnline: 912040 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61TCTGGTGACTATAGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTC
CTTAGCGTCGATGGTAGTCGAACTTACGTTCCGCTAGAGTAGAACGTTGCCAGGC60
115
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_Sa5SB [new locus tag: SACOL_RS02905 ]
- symbol: RrfB
- description: 5S ribosomal RNA
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]