⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_00070
- pan locus tag?: SAUPAN000910000
- symbol: SAOUHSC_00070
- pan gene symbol?: sarS
- synonym:
- product: accessory regulator-like protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_00070
- symbol: SAOUHSC_00070
- product: accessory regulator-like protein
- replicon: chromosome
- strand: -
- coordinates: 75400..76152
- length: 753
- essential: no [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919449 NCBI
- RefSeq: YP_498671 NCBI
- BioCyc: G1I0R-65 BioCyc
- MicrobesOnline: 1288565 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGAAATATAATAACCATGACAAAATTAGAGATTTTATAATCATTGAAGCATATATGTTT
CGTTTTAAGAAAAAAGTCAAGCCTGAAGTCGATATGACTATAAAAGAATTTATATTACTG
ACTTATTTATTTCATCAGCAAGAAAACACACTTCCATTTAAGAAGATTGTTTCAGATTTA
TGTTATAAACAATCGGATTTAGTACAGCATATAAAAGTACTTGTGAAACATTCATATATT
AGTAAAGTTCGAAGTAAAATTGATGAGCGTAATACTTACATTTCAATATCTGAAGAACAA
CGAGAGAAAATTGCAGAACGTGTTACATTGTTTGATCAAATCATTAAACAATTTAACCTT
GCAGATCAAAGTGAATCACAGATGATACCAAAAGATAGTAAAGAATTTCTAAACTTGATG
ATGTATACAATGTATTTCAAGAATATTATCAAAAAACATCTAACATTAAGTTTTGTAGAA
TTCACAATTCTAGCTATTATCACTTCTCAAAATAAAAACATCGTTCTTCTTAAAGATTTA
ATTGAAACAATCCACCATAAATACCCTCAAACTGTTAGAGCTCTCAATAATTTAAAAAAG
CAAGGCTATCTAATAAAAGAACGCTCAACTGAAGATGAAAGAAAAATTTTAATTCATATG
GATGACGCGCAGCAAGACCATGCTGAACAATTATTAGCTCAAGTGAATCAATTATTAGCA
GATAAAGATCATTTACATCTTGTTTTTGAATAA60
120
180
240
300
360
420
480
540
600
660
720
753
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_00070
- symbol: SAOUHSC_00070
- description: accessory regulator-like protein
- length: 250
- theoretical pI: 9.31072
- theoretical MW: 29889.6
- GRAVY: -0.3956
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions staphylococcal accessory regulator family (TIGR01889; HMM-score: 214.6)and 4 morehomoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 33.3)mobile rSAM pair MarR family regulator (TIGR04472; HMM-score: 14.8)Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 14.3)Mobile and extrachromosomal element functions Prophage functions putative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13.7)
- TheSEED :
- Staphylococcal accessory regulator S, SarS
- PFAM: HTH (CL0123) Staph_reg_Sar_Rot; Transcriptional regulator SarA/Rot (PF22381; HMM-score: 132.8)and 9 moreMarR_2; MarR family (PF12802; HMM-score: 42.3)MarR; MarR family (PF01047; HMM-score: 33.9)HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 29.1)Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 26)HTH_34; Winged helix DNA-binding domain (PF13601; HMM-score: 19.9)HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 14.6)no clan defined UPF0515; Uncharacterised protein UPF0515 (PF15135; HMM-score: 11.9)HTH (CL0123) MAGE; MAGE homology domain (PF01454; HMM-score: 11.8)PsbQ-like (CL0752) CYP38_PsbQ-like; Peptidyl-prolyl cis-trans isomerase CYP38-like, PsbQ-like domain (PF21329; HMM-score: 9.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 10
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8857
- Cytoplasmic Membrane Score: 0.0817
- Cell wall & surface Score: 0.005
- Extracellular Score: 0.0277
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002293
- TAT(Tat/SPI): 0.000172
- LIPO(Sec/SPII): 0.000393
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKYNNHDKIRDFIIIEAYMFRFKKKVKPEVDMTIKEFILLTYLFHQQENTLPFKKIVSDLCYKQSDLVQHIKVLVKHSYISKVRSKIDERNTYISISEEQREKIAERVTLFDQIIKQFNLADQSESQMIPKDSKEFLNLMMYTMYFKNIIKKHLTLSFVEFTILAIITSQNKNIVLLKDLIETIHHKYPQTVRALNNLKKQGYLIKERSTEDERKILIHMDDAQQDHAEQLLAQVNQLLADKDHLHLVFE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [2] [3]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [4]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
BMC Genomics: 2009, 10;291
[PubMed:19570206] [WorldCat.org] [DOI] (I e) - ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
K Tegmark, A Karlsson, S Arvidson
Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus.
Mol Microbiol: 2000, 37(2);398-409
[PubMed:10931334] [WorldCat.org] [DOI] (P p)A L Cheung, K Schmidt, B Bateman, A C Manna
SarS, a SarA homolog repressible by agr, is an activator of protein A synthesis in Staphylococcus aureus.
Infect Immun: 2001, 69(4);2448-55
[PubMed:11254606] [WorldCat.org] [DOI] (P p)B Saïd-Salim, P M Dunman, F M McAleese, D Macapagal, E Murphy, P J McNamara, S Arvidson, T J Foster, S J Projan, B N Kreiswirth
Global regulation of Staphylococcus aureus genes by Rot.
J Bacteriol: 2003, 185(2);610-9
[PubMed:12511508] [WorldCat.org] [DOI] (P p)Ronggui Li, Adhar C Manna, Shaodong Dai, Ambrose L Cheung, Gongyi Zhang
Crystal structure of the SarS protein from Staphylococcus aureus.
J Bacteriol: 2003, 185(14);4219-25
[PubMed:12837797] [WorldCat.org] [DOI] (P p)Katherine A Schmidt, Adhar C Manna, Ambrose L Cheung
SarT influences sarS expression in Staphylococcus aureus.
Infect Immun: 2003, 71(9);5139-48
[PubMed:12933857] [WorldCat.org] [DOI] (P p)Nadine McCallum, Markus Bischoff, Hideki Maki, Akihito Wada, Brigitte Berger-Bächi
TcaR, a putative MarR-like regulator of sarS expression.
J Bacteriol: 2004, 186(10);2966-72
[PubMed:15126456] [WorldCat.org] [DOI] (P p)Jinxin Gao, George C Stewart
Regulatory elements of the Staphylococcus aureus protein A (Spa) promoter.
J Bacteriol: 2004, 186(12);3738-48
[PubMed:15175287] [WorldCat.org] [DOI] (P p)Susham Ingavale, Willem van Wamel, Thanh T Luong, Chia Y Lee, Ambrose L Cheung
Rat/MgrA, a regulator of autolysis, is a regulator of virulence genes in Staphylococcus aureus.
Infect Immun: 2005, 73(3);1423-31
[PubMed:15731040] [WorldCat.org] [DOI] (P p)Jan Oscarsson, Caroline Harlos, Staffan Arvidson
Regulatory role of proteins binding to the spa (protein A) and sarS (staphylococcal accessory regulator) promoter regions in Staphylococcus aureus NTCC 8325-4.
Int J Med Microbiol: 2005, 295(4);253-66
[PubMed:16128400] [WorldCat.org] [DOI] (P p)
