From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_T00044
  • pan locus tag?: SAUPAN002272000
  • symbol: SAOUHSC_T00044
  • pan gene symbol?: trnaP
  • synonym:
  • product: tRNA-Pro

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: tRNA
  • locus tag: SAOUHSC_T00044
  • symbol: SAOUHSC_T00044
  • product: tRNA-Pro
  • replicon: chromosome
  • strand: +
  • coordinates: 492805..492878
  • length: 74
  • essential: unknown

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    CGGGAAGTAGCTCAGCTTGGTAGAGCACTTGGTTTGGGACCAAGGGGTCGCAGGTTCGAA
    TCCTGTCTTCCCGA
    60
    74

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_T00044
  • symbol: SAOUHSC_T00044
  • description: tRNA-Pro
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:
  • STRING:

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_T00044&oldid=97748"