Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_0507 [new locus tag: SAUSA300_RS02715 ]
- pan locus tag?: SAUPAN002287000
- symbol: ctsR
- pan gene symbol?: ctsR
- synonym:
- product: transcriptional regulator CtsR
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_0507 [new locus tag: SAUSA300_RS02715 ]
- symbol: ctsR
- product: transcriptional regulator CtsR
- replicon: chromosome
- strand: +
- coordinates: 566563..567024
- length: 462
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913623 NCBI
- RefSeq: YP_493210 NCBI
- BioCyc: see SAUSA300_RS02715
- MicrobesOnline: 1292022 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGCACAATATGTCTGACATCATAGAACAATACATCAAACGTTTATTTGAAGAGTCGAAT
GAAGATGTCGTTGAAATTCAGAGAGCGAATATCGCACAGCGTTTTGATTGCGTACCATCA
CAATTAAATTATGTAATCAAAACACGATTCACTAATGAACATGGTTATGAAATCGAAAGT
AAACGTGGTGGTGGTGGTTACATCCGAATCACTAAAATTGAAAATAAAGATGCAACAGGT
TATATTAATCATTTGCTTCAGCTGATTGGACCTTCTATTTCTCAACAACAAGCTTATTAT
ATTATTGATGGGCTTTTAGATAAAATGTTAATAAATGAACGTGAAGCTAAAATGATTCAA
GCAGTTATTGATAGAGAAACGCTATCAATGGATATGGTTTCTAGAGATATTATTAGAGCA
AATATTTTAAAACGTTTGTTACCAGTTATAAATTATTACTAA60
120
180
240
300
360
420
462
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_0507 [new locus tag: SAUSA300_RS02715 ]
- symbol: CtsR
- description: transcriptional regulator CtsR
- length: 153
- theoretical pI: 6.26841
- theoretical MW: 17841.4
- GRAVY: -0.333333
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- Transcriptional regulator CtsR
- PFAM: HTH (CL0123) CtsR; CtsR N-terminal HTH domain (PF05848; HMM-score: 123.3)and 2 moreno clan defined CtsR_C; CtsR C-terminal dimerization domain (PF17727; HMM-score: 81.7)HTH (CL0123) CENP-B_N; CENP-B N-terminal DNA-binding domain (PF04218; HMM-score: 13)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- genes regulated by CtsR, TF important in Heat shock response: in JSNZ, N315
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8314
- Cytoplasmic Membrane Score: 0.0998
- Cell wall & surface Score: 0.0009
- Extracellular Score: 0.0679
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006698
- TAT(Tat/SPI): 0.000733
- LIPO(Sec/SPII): 0.000878
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MHNMSDIIEQYIKRLFEESNEDVVEIQRANIAQRFDCVPSQLNYVIKTRFTNEHGYEIESKRGGGGYIRITKIENKDATGYINHLLQLIGPSISQQQAYYIIDGLLDKMLINEREAKMIQAVIDRETLSMDMVSRDIIRANILKRLLPVINYY
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
Class three stress gene regulon transcriptional repressor (CtsR) binds cooperatively with the heat-inducible transcriptional repressor (HrcA) to maintain low basal levels of chaperones under normal conditions. Under stress conditions, when chaperones are needed to ensure proper folding of proteins, CtsR and HrcA release their operators and allow transcription of target genes. The consensus CtsR operator sequence per RegPrecise is nnTSAMnnWnnKTSAnn
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]
- ↑ Arnaud Chastanet, Juliette Fert, Tarek Msadek
Comparative genomics reveal novel heat shock regulatory mechanisms in Staphylococcus aureus and other Gram-positive bacteria.
Mol Microbiol: 2003, 47(4);1061-73
[PubMed:12581359] [WorldCat.org] [DOI] (P p)