Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_2117 [new locus tag: SAUSA300_RS11660 ]
- pan locus tag?: SAUPAN005517000
- symbol: SAUSA300_2117
- pan gene symbol?: trnaQ
- synonym:
- product: tRNA-Gln
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: tRNA
- locus tag: SAUSA300_2117 [new locus tag: SAUSA300_RS11660 ]
- symbol: SAUSA300_2117
- product: tRNA-Gln
- replicon: chromosome
- strand: -
- coordinates: 2291927..2292001
- length: 75
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3915344 NCBI
- RefSeq:
- BioCyc: see SAUSA300_RS11660
- MicrobesOnline: 1293632 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61TGGGCTATAGCCAAGCGGTAAGGCAACGGACTTTGACTCCGTCACTCGTTGGTTCGAATC
CAGCTAGCCCAGCCA60
75
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_2117 [new locus tag: SAUSA300_RS11660 ]
- symbol: SAUSA300_2117
- description: tRNA-Gln
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.