From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS00310 [old locus tag: SAUSA300_0061 ]
  • pan locus tag?: SAUPAN000810000
  • symbol: SAUSA300_RS00310
  • pan gene symbol?: arcC
  • synonym:
  • product: carbamate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS00310 [old locus tag: SAUSA300_0061 ]
  • symbol: SAUSA300_RS00310
  • product: carbamate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 68890..69819
  • length: 930
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (68890..69819) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGTCTAAAATCGTCGTAGCTTTGGGTGGTAACGCTTTAGGACAATCGCCTAAAGAACAA
    TTAGATTTATTAAAAAGTACATCTAAATCTCTAGTAAGTTTAATCGATAAAGGATACGAA
    ATTGTAATTAGTCATGGTAATGGTCCACAAGTTGGAAGTATTAACTTAGGTTTAAATTAT
    GCGGCGGAACACAAACAAGGTCCTCCTTTTCCTTTCCCTGAATGTGGTGCTATGAGTCAA
    GCTTATATTGGCTATCAGATGCAAGAAAGTTTACAAAACGAACTTCATTCAATGGGCATA
    GATAAACAAGTTGTTACGCTAGTAACACAAGTTCAAGTTGCAAGCGATGATTCTGCTTTC
    AATAACCCTACTAAACCAATTGGATTATTTTATACAAAAGAGCAGGCTGATAAATTTACG
    AAAGAAAAAGGTTATACTTTTGTAGAAGATTCTGGACGCGGCTATCGTCGCGTTGTCCCT
    TCCCCACAACCTATAAGTATAGTTGAGTTAGATAGTATAGAAACATTAATCACTCATGGA
    ACACTAGTTATCGCTGCCGGCGGTGGTGGAATTCCAGTAATTAAGGAAAATGAAGTTTAT
    ACAGGTGTTGATGCAGTTATTGATAAAGATAAAACGAGTGCTTTATTAGCAGCACATTTA
    CAATCTGATCAATTAATCATATTAACTGCTGTGGACCATGTTTACATTAACTATGGAAAA
    GAAAACCAAAGAGGTCTCGATGAAGTGTCTGTGGATGAAATGAAAAAACATATCTCTGAT
    GGTCAATTTGCTAAAGGAAGTATGCTTCCAAAAGTTGAAGCTGCACTTCAATTTCTTGAA
    AAAAATACTAAAGGCAGTGTTTTGATTACATCTCTAGCAGGATTAGGGGACGCTTTAGAC
    GGTAAAATAGGAACATTAATTAAGAATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    930

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS00310 [old locus tag: SAUSA300_0061 ]
  • symbol: SAUSA300_RS00310
  • description: carbamate kinase
  • length: 309
  • theoretical pI: 5.37894
  • theoretical MW: 33156.5
  • GRAVY: -0.145631

Function[edit | edit source]

  • reaction:
    EC 2.7.2.2?  ExPASy
    Carbamate kinase ATP + NH3 + CO2 = ADP + carbamoyl phosphate
  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines carbamate kinase (TIGR00746; EC 2.7.2.2; HMM-score: 378.5)
    and 4 more
    Metabolism Amino acid biosynthesis Glutamate family acetylglutamate kinase (TIGR00761; EC 2.7.2.8; HMM-score: 47.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions putative uridylate kinase (TIGR02076; EC 2.7.4.-; HMM-score: 29.6)
    Metabolism Amino acid biosynthesis Glutamate family glutamate 5-kinase (TIGR01027; EC 2.7.2.11; HMM-score: 27.9)
    Metabolism Amino acid biosynthesis Glutamate family delta l-pyrroline-5-carboxylate synthetase (TIGR01092; HMM-score: 20.6)
  • TheSEED:
  • PFAM:
    no clan defined AA_kinase; Amino acid kinase family (PF00696; HMM-score: 112)
    and 1 more
    HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 14.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.030337
    • TAT(Tat/SPI): 0.001273
    • LIPO(Sec/SPII): 0.003738
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 445958902 NCBI
  • RefSeq: WP_000036757 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MSKIVVALGGNALGQSPKEQLDLLKSTSKSLVSLIDKGYEIVISHGNGPQVGSINLGLNYAAEHKQGPPFPFPECGAMSQAYIGYQMQESLQNELHSMGIDKQVVTLVTQVQVASDDSAFNNPTKPIGLFYTKEQADKFTKEKGYTFVEDSGRGYRRVVPSPQPISIVELDSIETLITHGTLVIAAGGGGIPVIKENEVYTGVDAVIDKDKTSALLAAHLQSDQLIILTAVDHVYINYGKENQRGLDEVSVDEMKKHISDGQFAKGSMLPKVEAALQFLEKNTKGSVLITSLAGLGDALDGKIGTLIKN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]