Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS02330 [old locus tag: SAUSA300_0435 ]
- pan locus tag?: SAUPAN002176000
- symbol: SAUSA300_RS02330
- pan gene symbol?: metN2
- synonym:
- product: methionine import ATP-binding protein MetN 1
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS02330 [old locus tag: SAUSA300_0435 ]
- symbol: SAUSA300_RS02330
- product: methionine import ATP-binding protein MetN 1
- replicon: chromosome
- strand: +
- coordinates: 488780..489805
- length: 1026
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (488780..489805) NCBI
- BioCyc: SAUSA300_RS02330 BioCyc
- MicrobesOnline: see SAUSA300_0435
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021ATGATTGAGTTTCGACAGGTAAGTAAGACCTTTAATAAAAAGAAGCAAAAAATAGATGCT
TTGAAGGACGTATCATTTACGGTCAATCGCAATGATATTTTTGGTGTGATTGGATATAGT
GGTGCAGGAAAAAGTACGTTGGTAAGACTCGTGAATCATCTTGAAGCTGCCTCGAATGGA
CAAGTGATTGTAGATGGACATGATATTACGAATTATAGCGATAAAATGATGAGGGATATT
AAGAAAGATATCGGTATGATATTTCAGCATTTCAATTTATTAAATTCAGCTACCGTATTT
AAAAATGTAGCAATGCCACTCATTTTAAGTAAGAAAAGCAAAACAGAAATTAAGCAACGA
GTAACGGAAATGCTTGAATTTGTAGGATTGAGTGATAAAAAAGACCAATTTCCTGATGAA
TTATCTGGTGGGCAGAAGCAAAGGGTGGCTATTGCAAGAGCGCTTGTTACTAATCCGAAA
ATACTCCTATGCGATGAAGCAACAAGCGCATTGGATCCAGCAACGACTGCTTCGATATTG
ACGTTATTAAAGAATGTCAATCAAACCTTTGGCATTACAATTATGATGATTACACATGAA
ATGCGCGTTATTAAAGACATTTGTAATCGTGTTGCTGTAATGGAAAAGGGGAAAGTGGTT
GAAACAGGAACTGTTAAAGAGGTGTTTAGTCATCCTAAAACGACGATTGCTCAAAATTTT
GTGTCTACAGTTATACAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAA
CAAGTTGGCGATTTTAAAGATTATAAAATCTTCGTCGAGGAAACTCAGGTGACACAACCG
ATTATAAATGACTTGATTCAAATTTGTGGCAGAGAGGTTAAAATTTTATTTTCATCTATG
TCAGAAATACAAGGTAACACCGTATGTTATATGTGGCTTCGATTTAATATGGATCAACAA
TTTGAAGACACGGCAATAAATCAATATTTCAAAGAGAAAAATATTCAATTTGAGGAGGTG
CATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1026
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS02330 [old locus tag: SAUSA300_0435 ]
- symbol: SAUSA300_RS02330
- description: methionine import ATP-binding protein MetN 1
- length: 341
- theoretical pI: 8.31235
- theoretical MW: 38675.5
- GRAVY: -0.198827
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 375.9)and 70 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 227)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 216.3)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 211.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 207.5)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 207.4)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 206.4)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 204.7)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 200.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 195.6)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 194.7)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 191.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 190.9)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 188.7)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 180.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 176.4)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 174.2)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 174.2)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 165.6)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 154.7)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 152.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 149.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 149.4)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 147.8)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 145.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 145.7)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 142.3)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 142.3)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 140)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 136.5)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 135.6)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.3)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.3)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 134.3)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 130.7)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 130.7)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 128.6)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 127.8)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 126.2)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 117.6)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 112.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 110.9)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 110.4)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 109.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 105.5)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 101.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 101.1)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 95.3)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 94.7)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 92.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.9)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 82.7)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 75.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 68.4)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59.9)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 56.7)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 56.7)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 55.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 42.2)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 34.8)
- TheSEED: see SAUSA300_0435
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.8)and 17 moreACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 40.2)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 26.2)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25)AAA_16; AAA ATPase domain (PF13191; HMM-score: 21.6)AAA_22; AAA domain (PF13401; HMM-score: 21.4)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.7)no clan defined DUF3652; Huntingtin protein region (PF12372; HMM-score: 16.6)P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 16.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.8)AAA_23; AAA domain (PF13476; HMM-score: 15)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 14.5)AAA_18; AAA domain (PF13238; HMM-score: 14.5)no clan defined DUF99; Protein of unknown function DUF99 (PF01949; HMM-score: 13.4)P-loop_NTPase (CL0023) AAA_17; AAA domain (PF13207; HMM-score: 13.1)SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 13.1)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.9)AAA_33; AAA domain (PF13671; HMM-score: 12.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.011972
- TAT(Tat/SPI): 0.00313
- LIPO(Sec/SPII): 0.000726
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI: 446491432 NCBI
- RefSeq: WP_000569286 NCBI
- UniProt: see SAUSA300_0435
⊟Protein sequence[edit | edit source]
- MIEFRQVSKTFNKKKQKIDALKDVSFTVNRNDIFGVIGYSGAGKSTLVRLVNHLEAASNGQVIVDGHDITNYSDKMMRDIKKDIGMIFQHFNLLNSATVFKNVAMPLILSKKSKTEIKQRVTEMLEFVGLSDKKDQFPDELSGGQKQRVAIARALVTNPKILLCDEATSALDPATTASILTLLKNVNQTFGITIMMITHEMRVIKDICNRVAVMEKGKVVETGTVKEVFSHPKTTIAQNFVSTVIQTEPSTSLIRRLNDEQVGDFKDYKIFVEETQVTQPIINDLIQICGREVKILFSSMSEIQGNTVCYMWLRFNMDQQFEDTAINQYFKEKNIQFEEVH
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SAUSA300_RS10295 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [1] (data from MRSA252) SAUSA300_RS00015 DNA polymerase III subunit beta [1] (data from MRSA252) SAUSA300_RS02845 elongation factor G [1] (data from MRSA252) SAUSA300_RS02850 elongation factor Tu [1] (data from MRSA252) SAUSA300_RS04560 NADH dehydrogenase [1] (data from MRSA252) SAUSA300_RS04700 hypothetical protein [1] (data from MRSA252) SAUSA300_RS05360 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) SAUSA300_RS05940 carbamoyl-phosphate synthase large chain [1] (data from MRSA252) SAUSA300_RS06220 30S ribosomal protein S2 [1] (data from MRSA252) SAUSA300_RS08050 acetyl-CoA carboxylase biotin carboxylase subunit [1] (data from MRSA252) SAUSA300_RS08390 molecular chaperone DnaJ [1] (data from MRSA252) SAUSA300_RS08910 aldehyde dehydrogenase [1] (data from MRSA252) SAUSA300_RS08950 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SAUSA300_RS08975 pyruvate kinase [1] (data from MRSA252) SAUSA300_RS09040 universal stress protein UspA [1] (data from MRSA252) SAUSA300_RS09465 S-adenosylmethionine synthase [1] (data from MRSA252) SAUSA300_RS10290 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [1] (data from MRSA252) SAUSA300_RS11600 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SAUSA300_RS12065 30S ribosomal protein S5 [1] (data from MRSA252) SAUSA300_RS12090 50S ribosomal protein L5 [1] (data from MRSA252) SAUSA300_RS12120 30S ribosomal protein S3 [1] (data from MRSA252) SAUSA300_RS13795 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CymR* see SAUSA300_0435
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)