From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS03490 [old locus tag: SAUSA300_0651 ]
  • pan locus tag?: SAUPAN002545000
  • symbol: SAUSA300_RS03490
  • pan gene symbol?:
  • synonym:
  • product: peptidase M23

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS03490 [old locus tag: SAUSA300_0651 ]
  • symbol: SAUSA300_RS03490
  • product: peptidase M23
  • replicon: chromosome
  • strand: -
  • coordinates: 726462..727259
  • length: 798
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (726462..727259) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    TTGAAAAAATTAGCATTTGCAATAACAGCAACATCTGGTGCAGCTGCATTTTTAACGCAT
    CATGATGCACAAGCTTCTACACAACATACAGTACAATCTGGTGAATCATTATGGAGTATT
    GCTCAAAAATACAACACTTCAGTAGAGAGTATTAAACAAAATAACCAATTAGATAACAAC
    TTGGTATTCCCTGGTCAAGTTATCTCAGTAGGTGGAAGTGATGCACAAAATACGTCAAAC
    ACTTCTCCACAAGCTGGTTCAGCATCATCTCATACTGTACAAGCTGGTGAATCATTAAAT
    ATCATTGCTAGCAGATATGGTGTTTCAGTTGATCAATTAATGGCAGCCAATAACTTACGT
    GGTTATTTAATTATGCCTAACCAAACATTACAAATTCCTAATGGTGGATCAGGTGGTACA
    ACACCAACAGCTACAACAGGTAGCAATGGCAATGCATCATCTTTTAATCACCAAAATTTA
    TACACTGCTGGTCAATGTACATGGTACGTATTTGACCGTCGTGCTCAAGCTGGTAGTCCA
    ATTAGCACATATTGGTCAGACGCTAAGTATTGGGCTGGTAACGCAGCTAATGATGGTTAC
    CAAGTAAACAACACACCATCAGTTGGTTCAATTATGCAAAGCACACCTGGTCCATATGGT
    CATGTTGCTTATGTTGAACGTGTCAATGGTGATGGTAGTATCTTGATTTCTGAAATGAAT
    TACACATATGGTCCATACAATATGAACTACCGTACAATTCCAGCTTCAGAAGTTTCTAGC
    TATGCATTCATCCATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    798

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS03490 [old locus tag: SAUSA300_0651 ]
  • symbol: SAUSA300_RS03490
  • description: peptidase M23
  • length: 265
  • theoretical pI: 6.62611
  • theoretical MW: 28186.6
  • GRAVY: -0.392075

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Sporulation and germination spore coat assembly protein SafA (TIGR02899; HMM-score: 63.9)
    and 1 more
    Cellular processes Cellular processes Sporulation and germination stage VI sporulation protein D (TIGR02907; HMM-score: 41.2)
  • TheSEED:
  • PFAM:
    LysM (CL0187) LysM; LysM domain (PF01476; HMM-score: 100.3)
    and 1 more
    Peptidase_CA (CL0125) CHAP; CHAP domain (PF05257; HMM-score: 55.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 9.21
    • Extracellular Score: 0.78
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 25 aa
    • SP(Sec/SPI): 0.982953
    • TAT(Tat/SPI): 0.004467
    • LIPO(Sec/SPII): 0.002627
    • Cleavage Site: CS pos: 25-26. AQA-ST. Pr: 0.9495
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446654298 NCBI
  • RefSeq: WP_000731644 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKKLAFAITATSGAAAFLTHHDAQASTQHTVQSGESLWSIAQKYNTSVESIKQNNQLDNNLVFPGQVISVGGSDAQNTSNTSPQAGSASSHTVQAGESLNIIASRYGVSVDQLMAANNLRGYLIMPNQTLQIPNGGSGGTTPTATTGSNGNASSFNHQNLYTAGQCTWYVFDRRAQAGSPISTYWSDAKYWAGNAANDGYQVNNTPSVGSIMQSTPGPYGHVAYVERVNGDGSILISEMNYTYGPYNMNYRTIPASEVSSYAFIH

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]