From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS04885 [old locus tag: SAUSA300_0908 ]
  • pan locus tag?: SAUPAN003178000
  • symbol: SAUSA300_RS04885
  • pan gene symbol?: ppnK
  • synonym:
  • product: NAD(+) kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS04885 [old locus tag: SAUSA300_0908 ]
  • symbol: SAUSA300_RS04885
  • product: NAD(+) kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 994970..995779
  • length: 810
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (994970..995779) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGCGTTATACAATTTTAACTAAAGGTGACTCCAAGTCTAATGCCTTAAAGCATAAAATG
    ATGAACTATATGAAAGATTTTCGCATGATTGAGGATAGTGAAAATCCTGAAATTGTTATT
    TCAGTTGGTGGTGACGGTACATTACTACAAGCATTCCATCAGTATAGCCACATGTTATCA
    AAAGTGGCATTTGTTGGAGTTCATACAGGTCATTTAGGATTTTATGCGGATTGGTTACCT
    CATGAAGTTGAAAAATTAATCATCGAAATTAATAATTCAGAGTTTCAGGTCATTGAATAT
    CCATTGCTTGAAATTATTATGAGATACAACGACAACGGCTATGAAACAAGGTATTTAGCA
    TTAAATGAAGCAACGATGAAAACTGAAAATGGCTCAACACTTGTTGTGGATGTTAACTTA
    AGAGGGAAACACTTTGAGCGATTTAGAGGCGATGGATTATGTGTATCAACACCTTCGGGT
    TCAACGGCTTATAACAAAGCGCTAGGTGGCGCACTGATACATCCTTCACTTGAAGCAATG
    CAAATTACAGAAATTGCCTCGATAAATAATCGTGTGTTTAGAACGGTAGGATCACCACTT
    GTATTACCAAAGCATCATACATGTTTAATATCACCAGTTAATCATGATACCATTAGAATG
    ACGATAGATCATGTTAGTATCAAACATAAAAATGTTAATTCAATACAATACCGTGTAGCA
    AATGAAAAAGTGAGGTTTGCACGTTTTAGACCATTCCCATTCTGGAAACGTGTGCACGAT
    TCTTTCATATCAAGTGATGAAGAACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    810

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS04885 [old locus tag: SAUSA300_0908 ]
  • symbol: SAUSA300_RS04885
  • description: NAD(+) kinase
  • length: 269
  • theoretical pI: 8.264
  • theoretical MW: 30769
  • GRAVY: -0.310037

Function[edit | edit source]

  • reaction:
    EC 2.7.1.23?  ExPASy
    NAD+ kinase ATP + NAD+ = ADP + NADP+
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    PFK (CL0240) NAD_kinase; ATP-NAD kinase (PF01513; HMM-score: 92.1)
    and 1 more
    CDA (CL0109) LmjF365940-deam; A distinct subfamily of CDD/CDA-like deaminases (PF14421; HMM-score: 11.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: a divalent metal cation
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004379
    • TAT(Tat/SPI): 0.000146
    • LIPO(Sec/SPII): 0.000406
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 447193578 NCBI
  • RefSeq: WP_001270834 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MRYTILTKGDSKSNALKHKMMNYMKDFRMIEDSENPEIVISVGGDGTLLQAFHQYSHMLSKVAFVGVHTGHLGFYADWLPHEVEKLIIEINNSEFQVIEYPLLEIIMRYNDNGYETRYLALNEATMKTENGSTLVVDVNLRGKHFERFRGDGLCVSTPSGSTAYNKALGGALIHPSLEAMQITEIASINNRVFRTVGSPLVLPKHHTCLISPVNHDTIRMTIDHVSIKHKNVNSIQYRVANEKVRFARFRPFPFWKRVHDSFISSDEER

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]