Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS05010 [old locus tag: SAUSA300_0933 ]
- pan locus tag?: SAUPAN003218000
- symbol: SAUSA300_RS05010
- pan gene symbol?: —
- synonym:
- product: putative holin-like toxin
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS05010 [old locus tag: SAUSA300_0933 ]
- symbol: SAUSA300_RS05010
- product: putative holin-like toxin
- replicon: chromosome
- strand: +
- coordinates: 1022394..1022501
- length: 108
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (1022394..1022501) NCBI
- BioCyc: SAUSA300_RS05010 BioCyc
- MicrobesOnline: see SAUSA300_0933
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACT
TTCATTGGTATAGTAGTAGCAATAATAAATTTAAGCAATAAAAAATAA60
108
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS05010 [old locus tag: SAUSA300_0933 ]
- symbol: SAUSA300_RS05010
- description: putative holin-like toxin
- length: 35
- theoretical pI: 10.8054
- theoretical MW: 3820.74
- GRAVY: 1.52571
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: see SAUSA300_0933
- PFAM: no clan defined Hol_Tox; Putative Holin-like Toxin (Hol-Tox) (PF16935; HMM-score: 46.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0001
- Cytoplasmic Membrane Score: 0.9614
- Cell wall & surface Score: 0
- Extracellular Score: 0.0385
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.061469
- TAT(Tat/SPI): 0.006384
- LIPO(Sec/SPII): 0.024163
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
- GI: 487704336 NCBI
- RefSeq: WP_001788568 NCBI
- UniProt: see SAUSA300_0933
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MISIANALHLMLSFGMFIVTFIGIVVAIINLSNKK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]