Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS10670 [old locus tag: SAUSA300_1945 ]
- pan locus tag?: SAUPAN001381000
- symbol: SAUSA300_RS10670
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS10670 [old locus tag: SAUSA300_1945 ]
- symbol: SAUSA300_RS10670
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2110792..2110992
- length: 201
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (2110792..2110992) NCBI
- BioCyc: SAUSA300_RS10670 BioCyc
- MicrobesOnline: see SAUSA300_1945
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGTGGATTACTATGACTATTGTATTTGCTATATTGCTATTAGTTTGTATCAGTATTAAT
AGTGATCGTGCAAGGGAGATACAAGCGCTCAGATATATGAATGATTATCTACTTGATGAA
GTAGTTAAAACTAAAGGATACAACGGGTTAAAAGAATACAGGATTGAATTAAAGCGAATG
AATAACGATATTAAAAAGTAA60
120
180
201
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS10670 [old locus tag: SAUSA300_1945 ]
- symbol: SAUSA300_RS10670
- description: hypothetical protein
- length: 66
- theoretical pI: 9.54176
- theoretical MW: 7869.32
- GRAVY: -0.0606061
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: see SAUSA300_1945
- PFAM: no clan defined DUF1514; Protein of unknown function (DUF1514) (PF07438; HMM-score: 127.1)and 1 moreOAD_gamma; Oxaloacetate decarboxylase, gamma chain (PF04277; HMM-score: 11.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0078
- Cytoplasmic Membrane Score: 0.5755
- Cell wall & surface Score: 0.0022
- Extracellular Score: 0.4145
- LocateP:
- SignalP: Signal peptide LIPO(Sec/SPII) length 15 aa
- SP(Sec/SPI): 0.390369
- TAT(Tat/SPI): 0.000699
- LIPO(Sec/SPII): 0.507199
- Cleavage Site: CS pos: 15-16. LLV-CI. Pr: 0.4579
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
- GI: 446187188 NCBI
- RefSeq: WP_000265043 NCBI
- UniProt: see SAUSA300_1945
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MWITMTIVFAILLLVCISINSDRAREIQALRYMNDYLLDEVVKTKGYNGLKEYRIELKRMNNDIKK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]