From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS10920 [old locus tag: SAUSA300_1986 ]
  • pan locus tag?: SAUPAN005269000
  • symbol: SAUSA300_RS10920
  • pan gene symbol?:
  • synonym:
  • product: nitroreductase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS10920 [old locus tag: SAUSA300_1986 ]
  • symbol: SAUSA300_RS10920
  • product: nitroreductase
  • replicon: chromosome
  • strand: +
  • coordinates: 2144203..2144829
  • length: 627
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2144203..2144829) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGGGCTTATTTAAAAAAGATAAAAAAGCAATGACTTTTGACAATGCAATGGAAGAAAGA
    CGTTCAATATATAATTTGAAAGATTCGATATCAATTAGCGATGACGAATTAGAATCAATG
    ATTGCACATGCAGTTAAACATGTTCCTTCATCATTTAATTCTCAATCAACTAGAATTGTT
    CTCTTGTTAAATGACAACAATAATAAATTTTGGGATAACACAAAAGCAATTTTAAAAGAA
    GTCATGGGAGAGAATCGTGATTTCGAGCCAACTGAACAAAAAATTGATAACTTCAAACAT
    TCATACGGTACAATTTTGTTTTATGAAGATCAAGATGTTGTAAGTGGTTTACAAGAACAA
    ATGCCAAACTACTATGATAATTTTGCAATATGGTCAACTCAAACAAATGCCATGCATCAA
    TTTGCAATTTGGACTGCATTAGCTACTAAAGGCATAGGTGCTTCATTACAACACTATAAT
    CCACTTGTTGATGAGATGACTTCAAATGAATTTAATATTCCTAAAAGTTGGAAACTTATT
    GCTCAAATGCCATTTGGTGATATTCGTGAAGCTGCTGGCGAAAAAACATTTAATCCAGTG
    GAAGATCGTTTCGTAATAAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    627

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS10920 [old locus tag: SAUSA300_1986 ]
  • symbol: SAUSA300_RS10920
  • description: nitroreductase
  • length: 208
  • theoretical pI: 5.11779
  • theoretical MW: 24003.9
  • GRAVY: -0.564423

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin 5,6-dimethylbenzimidazole synthase (TIGR02476; EC 1.14.99.40; HMM-score: 20.4)
    and 1 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other F420 biosynthesis protein FbiB, C-terminal domain (TIGR03553; HMM-score: 15.8)
  • TheSEED:
  • PFAM:
    FMN-dep-NRtase (CL0529) Nitroreductase; Nitroreductase family (PF00881; HMM-score: 55.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003756
    • TAT(Tat/SPI): 0.000526
    • LIPO(Sec/SPII): 0.000394
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446444529 NCBI
  • RefSeq: WP_000522384 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MGLFKKDKKAMTFDNAMEERRSIYNLKDSISISDDELESMIAHAVKHVPSSFNSQSTRIVLLLNDNNNKFWDNTKAILKEVMGENRDFEPTEQKIDNFKHSYGTILFYEDQDVVSGLQEQMPNYYDNFAIWSTQTNAMHQFAIWTALATKGIGASLQHYNPLVDEMTSNEFNIPKSWKLIAQMPFGDIREAAGEKTFNPVEDRFVIKK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]