From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS14070 [old locus tag: SAUSA300_2536 ]
  • pan locus tag?: SAUPAN006295000
  • symbol: SAUSA300_RS14070
  • pan gene symbol?: budA2
  • synonym:
  • product: alpha-acetolactate decarboxylase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS14070 [old locus tag: SAUSA300_2536 ]
  • symbol: SAUSA300_RS14070
  • product: alpha-acetolactate decarboxylase
  • replicon: chromosome
  • strand: -
  • coordinates: 2736736..2737440
  • length: 705
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2736736..2737440) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACGAATGTCTTGTATCAACATGGTACATTAGGTACGTTAATGGCTGGCTTACTAGAA
    GGCACAGCTACAATTAATGAATTGTTAGAACATGGGAATTTAGGGATTGCAACGTTAACA
    GGGTCTGATGGCGAAGTAATATTTTTAGACGGAAAGGCATATCATGCTAACGAGCATAAA
    GAATTTATAGAATTAAAAGGCGATGAGAAAGTACCGTATGCATCGATTACTAATTTTAAA
    GCGAGTAAGACATTTCCATTGCAACAATTATCACAAGATGATGTATTTGCACAAATTAAA
    AATGAAATGTTAAGTGAGAATTTATTTTCGGCTGTTAAAATTTATGGCACATTTAAACAT
    ATGCATGTACGAATGATGCCTGCTCAGCAACCGCCATATACACGTTTGATTGATTCAGCA
    CGCAGACAACCTGAGGAAAAAAGACAAGATATTCGTGGTGCCATTGTTGGATTTTTTACA
    CCAGAATTATTTCATGGCGTAGGGTCTGCTGGTTTTCATATACATTTTGCGGATGATGAA
    AGAGCTTATGGTGGACATGTTCTTGACTTTGAAGTGGATGACGTTGTCGTTGAGATACAA
    AACTTTGAAACATTCCAACAACATTTCCCGGTAAATAACGAGACGTTTGTTAAAGCGAAA
    ATAGACTATAAAGATGTGGCAGAAGAAATTAGAGAAGCTGAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    705

Protein[edit | edit source]

Protein Data Bank: 1XV2

General[edit | edit source]

  • locus tag: SAUSA300_RS14070 [old locus tag: SAUSA300_2536 ]
  • symbol: SAUSA300_RS14070
  • description: alpha-acetolactate decarboxylase
  • length: 234
  • theoretical pI: 4.90649
  • theoretical MW: 26406.5
  • GRAVY: -0.342735

Function[edit | edit source]

  • reaction:
    EC 4.1.1.5?  ExPASy
    Acetolactate decarboxylase (2S)-2-hydroxy-2-methyl-3-oxobutanoate = (3R)-3-hydroxybutan-2-one + CO2
  • TIGRFAM:
    Metabolism Energy metabolism Fermentation alpha-acetolactate decarboxylase (TIGR01252; EC 4.1.1.5; HMM-score: 245)
  • TheSEED:
  • PFAM:
    ALDC (CL0615) AAL_decarboxy; Alpha-acetolactate decarboxylase (PF03306; HMM-score: 249.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.052529
    • TAT(Tat/SPI): 0.001744
    • LIPO(Sec/SPII): 0.022575
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446108262 NCBI
  • RefSeq: WP_000186117 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTNVLYQHGTLGTLMAGLLEGTATINELLEHGNLGIATLTGSDGEVIFLDGKAYHANEHKEFIELKGDEKVPYASITNFKASKTFPLQQLSQDDVFAQIKNEMLSENLFSAVKIYGTFKHMHVRMMPAQQPPYTRLIDSARRQPEEKRQDIRGAIVGFFTPELFHGVGSAGFHIHFADDERAYGGHVLDFEVDDVVVEIQNFETFQQHFPVNNETFVKAKIDYKDVAEEIREAE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]