From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS15605
  • pan locus tag?:
  • symbol: SAUSA300_RS15605
  • pan gene symbol?:
  • synonym:
  • product: short-chain dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS15605
  • symbol: SAUSA300_RS15605
  • product: short-chain dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 2602665..2602751
  • length: 87
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2602665..2602751) NCBI
  • BioCyc: SAUSA300_RS15605 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    ATGAAACGTTTGGAAAATAAAGTAGCAGTCGTAACAGGAGCAAGTACAGGTATCGGTCAA
    GCTTCTGCAATCGCTTTAGCTCAATAA
    60
    87

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS15605
  • symbol: SAUSA300_RS15605
  • description: short-chain dehydrogenase
  • length: 28
  • theoretical pI: 10.789
  • theoretical MW: 2785.24
  • GRAVY: 0.407143

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 25.1)
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 23.9)
    and 8 more
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 16.7)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 16.4)
    rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 16.1)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 13.8)
    2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 13.8)
    Metabolism Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 13.3)
    sepiapterin reductase (TIGR01500; EC 1.1.1.153; HMM-score: 13.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll light-dependent protochlorophyllide reductase (TIGR01289; EC 1.3.1.33; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Eno-Rase_NADH_b; NAD(P)H binding domain of trans-2-enoyl-CoA reductase (PF12242; HMM-score: 20)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 19.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.402791
    • TAT(Tat/SPI): 0.068103
    • LIPO(Sec/SPII): 0.117247
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_000824926 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKRLENKVAVVTGASTGIGQASAIALAQ

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]