COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

⊟Summary

• organism: Staphylococcus aureus N315
• locus tag: SA_RS00485
• pan locus tag^?:
• symbol: SA_RS00485
• pan gene symbol^?: —
• synonym:
• product: potassium-transporting ATPase subunit F

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: SA_RS00485
• symbol: SA_RS00485
• product: potassium-transporting ATPase subunit F
• replicon: chromosome
• strand: +
• coordinates: 77015..77095
• length: 81
• essential: unknown

⊟Accession numbers

• Location: NC_002745 (77015..77095) NCBI
• BioCyc: SA_RS00485 BioCyc
• MicrobesOnline:

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  
  ATGATTACACTATTAGCTGTCGTTGTCATCGCATTAATTTTATTTTTATTTTACGCATTA
  ATTTGGAGTGAAAAATTTTAA
  60
  81
  

⊟Protein

⊟General

• locus tag: SA_RS00485
• symbol: SA_RS00485
• description: potassium-transporting ATPase subunit F
• length: 26
• theoretical pI: 6.40195
• theoretical MW: 3027.8
• GRAVY: 2.23077

⊟Function

• TIGRFAM:
  Metabolism Transport and binding proteins Cations and iron carrying compounds K+-transporting ATPase, F subunit (TIGR02115; EC 3.6.3.12; HMM-score: 27.7)
• TheSEED:
• PFAM:
  no clan defined Potass_KdpF; F subunit of K+-transporting ATPase (Potass_KdpF) (PF09604; HMM-score: 29.8)
  and 3 more
  P12; Virus attachment protein p12 family (PF12669; HMM-score: 10.4)
  EpsM (CL0331) T2SSM; Type II secretion system (T2SS), protein M (PF04612; HMM-score: 8.9)
  no clan defined ODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 8.9)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.32
  • Cytoplasmic Membrane Score: 9.55
  • Cellwall Score: 0.12
  • Extracellular Score: 0.01
  • Internal Helix: 1
• LocateP:
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.127549
  • TAT(Tat/SPI): 0.006219
  • LIPO(Sec/SPII): 0.052696
• predicted transmembrane helices (TMHMM): 1

⊟Accession numbers

• GI: 446554228 NCBI
• RefSeq: WP_000631574 NCBI
• UniProt:

⊟Protein sequence

• MITLLAVVVIALILFLFYALIWSEKF

⊟Experimental data

• experimentally validated:
• protein localization:
• quantitative data / protein copy number per cell:
• interaction partners:

⊟Expression & Regulation

⊟Operon

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: no data available

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications