From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS01765 [old locus tag: SA0306 ]
  • pan locus tag?: SAUPAN001241000
  • symbol: SA_RS01765
  • pan gene symbol?: nanR
  • synonym:
  • product: MurR/RpiR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS01765 [old locus tag: SA0306 ]
  • symbol: SA_RS01765
  • product: MurR/RpiR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 361988..362788
  • length: 801
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (361988..362788) NCBI
  • BioCyc: G1G21-332 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAATTTGAGAATCGTGTTCAACGTTATCAACATTTATTTACAAAAACTGATAAACGC
    ATCGTCAATTATATAAGACAAAATGGTTATAGCGATGCCTTTTCAACGATTAACTCCTTA
    GCCCATGCGATTGGTACATCACCAGCAACGATGACACGCTTTAGTCATAAGCTAGATTAT
    GAGAATTTCCAAGATTTAAAATTTAATATTCAACAAGAAATGACAGAGACAGTTATTGAA
    AATAGCCCAATTATTCAAAGAATTCATAAATATCATCAACAAATCATTCAACAAACTGGT
    GAATTTATTGATAACGACATTATCCAAACCTTTATCGACAAACTCCAATCAAGTCGACAT
    ATACTCTTTGCTGGACTAGGTAGCTCTGGTTTATCAGCGACTGAATTTTATTATCGTATG
    ATTCGTATGGGGCTAAAAGGTAATGTTACTACCGATTCACATTTAATGAAAATATCGGCA
    TCCCTACTATCTCATTCGGACATGTTTATTGCTATGTCAAATAGTGGTAATACTTCGGAA
    TTAATTTCAGCAGCGGAAGTCGCCAAATCTCATGGTGCATATGTCGTTGCCATCACAAAT
    TTCGAAGGTAGTAAACTTACAGATTGTGCAGATTTAGTACTTTTAACAACGGATCAATCG
    CGTAATACCGACCATCAATTTATCAACACACAAATTGCGACACTCTTTTTAATCGATATC
    GTGAGTTATCATTTATTAGAAAATACAAATCTGAGTCAAACTTATCAACATACTAAATCT
    ATTATCCTAGACAACAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS01765 [old locus tag: SA0306 ]
  • symbol: SA_RS01765
  • description: MurR/RpiR family transcriptional regulator
  • length: 266
  • theoretical pI: 6.97071
  • theoretical MW: 30258
  • GRAVY: -0.282707

Function[edit | edit source]

  • TIGRFAM:
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 73.6)
    and 7 more
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    Metabolism Central intermediary metabolism Amino sugars glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    bifunctional phosphoglucose/phosphomannose isomerase (TIGR02128; EC 5.3.1.9; HMM-score: 33.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides phosphoheptose isomerase (TIGR00441; EC 5.3.1.28; HMM-score: 27.7)
    Metabolism Energy metabolism Sugars sugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 23.9)
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan N-acetylmuramic acid 6-phosphate etherase (TIGR00274; EC 4.2.1.126; HMM-score: 21.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 14.3)
  • TheSEED:
  • PFAM:
    SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 57.8)
    HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 50.5)
    and 6 more
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 42.8)
    HTH (CL0123) Dimerisation2; Dimerisation domain (PF16864; HMM-score: 19)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.3)
    no clan defined TyrRSs_C; Tyrosyl-tRNA synthetase C-terminal domain (PF16714; HMM-score: 14.1)
    DUF1643; Protein of unknown function (DUF1643) (PF07799; HMM-score: 13)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 12.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023801
    • TAT(Tat/SPI): 0.008751
    • LIPO(Sec/SPII): 0.003808
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446590036 NCBI
  • RefSeq: WP_000667382 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKFENRVQRYQHLFTKTDKRIVNYIRQNGYSDAFSTINSLAHAIGTSPATMTRFSHKLDYENFQDLKFNIQQEMTETVIENSPIIQRIHKYHQQIIQQTGEFIDNDIIQTFIDKLQSSRHILFAGLGSSGLSATEFYYRMIRMGLKGNVTTDSHLMKISASLLSHSDMFIAMSNSGNTSELISAAEVAKSHGAYVVAITNFEGSKLTDCADLVLLTTDQSRNTDHQFINTQIATLFLIDIVSYHLLENTNLSQTYQHTKSIILDNK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]