From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS03655 [old locus tag: SA0639 ]
  • pan locus tag?: SAUPAN002568000
  • symbol: SA_RS03655
  • pan gene symbol?: cydD
  • synonym:
  • product: cysteine ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS03655 [old locus tag: SA0639 ]
  • symbol: SA_RS03655
  • product: cysteine ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 731989..733620
  • length: 1632
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (731989..733620) NCBI
  • BioCyc: G1G21-720 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    GTGAAAAAATTAACAACAATACTGTTTCAATATAAAATTTTTCCGGTACTCATGTTCTTG
    GTCAGTACTGGTCTCGGCATACTCGTTATAACGCAAAATATTTTAATAGCAGATTTTTTA
    GCTAAAATTATAAGACATCAATTTCAAGGTTTATGGATTGTATTATTTATTTTATTAGGT
    GTTTTACTTTTAAGAGCAACTGTGCAATTTCTAAATCAATGGTTAGGTGATACATTAGCA
    TTTAAAGTTAAGCATATGCTTAGACAGCGGGTTATTTATAAAAATAATGGTCATCCAATC
    GGTGAACAAATGACTATACTCACAGAAAACATTGATGGTTTAGCACCTTTTTATAAGAGT
    TATTTGCCTCAAGTGTTCAAATCAATGATGGTTCCGCTCATCATAATCATTGCAATGTTT
    TTCATCCATTTCAATACCGCATTAATTATGTTAATAACTGCACCATTTATTCCTTTGTTT
    TATATTATTTTCGGTTTGAAAACGCGAGATGAGTCAAAAAATCAAATGACTTATTTGAAT
    CAATTTAGTCAACGGTTTTTAAATATTGCTAAAGGTTTAGTGACGTTAAAGCTATTTAAT
    CGTACAGAGCAAACAGAGAAGCATATTTACGACGATAGTACTCAGTTTAGAACTTTAACA
    ATGCGCATTTTACGCAGTGCTTTTTTATCGGGATTAATGCTCGAATTTATAAGTATGTTA
    GGTATTGGATTGGTTGCATTGGAAGCAACGCTAAGCTTAGTAGTATTTCATAATATTGAT
    TTTAAAACTGCGGCAATTGCGATTATTTTAGCGCCTGAATTTTATAATGCAATTAAGGAC
    TTAGGGCAAGCGTTCCATACTGGAAAACAAAGTGAAGGTGCCAGTGACGTTGTGTTTGAG
    TTTTTAGAACAACCGAACTATAATAATGAATTTCTATTAAAGTATGAGGAAAACCAAAAG
    CCATTTATTCAGTTAACAGACATATCATTTCGATATGATGATTCTGATAGATTGGTATTA
    AATGATTTAAATTTGGAAATATTTAAAGGTGATCAAATTGCACTTGTAGGTCCAAGCGGG
    GCAGGTAAATCCACTTTGACACATCTTATTGCAGGTGTTTATCAGCCAACAATAGGTACT
    ATAAGTACAAACCAGCGTGATTTAAATATAGGAATACTTAGTCAACAGCCATATATTTTC
    AGTGCTTCTATAAAAGAGAATATTACGATGTTTAAAGATATAGAAAATAATACTATTGAA
    GAAGTGCTAGACGAAGTAGGTTTATTAGACAAAGTGCAATCTTTCACAAAAGGCATTAAC
    ACAATAATAGGTGAAGGAGGCGAAATGTTATCTGGTGGACAGATGAGACGCATAGAACTT
    TGCCGTCTTTTAGTTATGAAGCCAGATCTCGTTATATTTGATGAGCCTGCAACTGGTTTA
    GATATTCAAACAGAACACATGATTCAGAACGTTCTGTTTCAACATTTTAAAGATACAACG
    ATGATTGTCATTGCACATAGAGATAATACAATTCGCCATTTACAACGACGCTTGTATATA
    GAAAATGGAAGACTGATTGCTGATGATCGCAATATTTCAGTAAATATAACAGAAAATGGT
    GATGACTTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1632

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS03655 [old locus tag: SA0639 ]
  • symbol: SA_RS03655
  • description: cysteine ABC transporter ATP-binding protein
  • length: 543
  • theoretical pI: 6.52112
  • theoretical MW: 61907.9
  • GRAVY: 0.194107

Function[edit | edit source]

  • TIGRFAM:
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 407.5)
    and 72 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 193.6)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 193.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 192.4)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 185.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 185.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 182.9)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 164.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 157.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 147.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 147.7)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 143.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 143.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 139.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 128.8)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 128.8)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 128.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 102)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 95.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 94)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 92)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 91.7)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 86)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 84.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 84)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 84)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 84)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 81.2)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 79.7)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 79.7)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 77.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 77)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 77)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 76.3)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 75.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 75.7)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 75.1)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 75)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 75)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 74.9)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 74.4)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 74.4)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 73.4)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 73.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 72.8)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 72.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 70.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 69.3)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 69.1)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 66.1)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 65)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 65)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 63.8)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 63.3)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 63.1)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 62.2)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 60.2)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 59.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 55.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 53.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 52.8)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 49)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 46.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 44.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 43.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 40.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 40.9)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 40.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 37.5)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 37)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 26.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 13.9)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 13.2)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 96)
    and 15 more
    ABC_membrane (CL0241) ABC_membrane; ABC transporter transmembrane region (PF00664; HMM-score: 63.7)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25.7)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 21.1)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.7)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 15.1)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 15)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 14.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
    no clan defined SVM_signal; SVM protein signal sequence (PF12113; HMM-score: 13.6)
    P-loop_NTPase (CL0023) IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.5)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 13.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.1)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.9)
    AAA_18; AAA domain (PF13238; HMM-score: 12.4)
    Chelatase (CL0043) Peripla_BP_2; Periplasmic binding protein (PF01497; HMM-score: 11.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004072
    • TAT(Tat/SPI): 0.000112
    • LIPO(Sec/SPII): 0.094294
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit | edit source]

  • GI: 446659816 NCBI
  • RefSeq: WP_000737162 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKKLTTILFQYKIFPVLMFLVSTGLGILVITQNILIADFLAKIIRHQFQGLWIVLFILLGVLLLRATVQFLNQWLGDTLAFKVKHMLRQRVIYKNNGHPIGEQMTILTENIDGLAPFYKSYLPQVFKSMMVPLIIIIAMFFIHFNTALIMLITAPFIPLFYIIFGLKTRDESKNQMTYLNQFSQRFLNIAKGLVTLKLFNRTEQTEKHIYDDSTQFRTLTMRILRSAFLSGLMLEFISMLGIGLVALEATLSLVVFHNIDFKTAAIAIILAPEFYNAIKDLGQAFHTGKQSEGASDVVFEFLEQPNYNNEFLLKYEENQKPFIQLTDISFRYDDSDRLVLNDLNLEIFKGDQIALVGPSGAGKSTLTHLIAGVYQPTIGTISTNQRDLNIGILSQQPYIFSASIKENITMFKDIENNTIEEVLDEVGLLDKVQSFTKGINTIIGEGGEMLSGGQMRRIELCRLLVMKPDLVIFDEPATGLDIQTEHMIQNVLFQHFKDTTMIVIAHRDNTIRHLQRRLYIENGRLIADDRNISVNITENGDDL

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]