From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS05640 [old locus tag: SA0995 ]
  • pan locus tag?: SAUPAN003388000
  • symbol: SA_RS05640
  • pan gene symbol?: sdhA
  • synonym:
  • product: succinate dehydrogenase flavoprotein subunit

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS05640 [old locus tag: SA0995 ]
  • symbol: SA_RS05640
  • product: succinate dehydrogenase flavoprotein subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1128026..1129792
  • length: 1767
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (1128026..1129792) NCBI
  • BioCyc: G1G21-1136 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    ATGGCAGAGAAACATCTTATTGTTGTCGGAGGTGGCCTAGCGGGCTTAATGTCAACAATT
    AAAGCGGCAGAAAAAGGTGCACATGTAGATTTGTTCTCAGTTGTACCAGTAAAGCGTTCG
    CACTCTGTTTGTGCCCAAGGTGGCATTAATGGTGCGGTCAATACTAAAGGGGAAGGCGAT
    TCTCCTTGGATTCACTTTGATGATACAGTGTATGGTGGCGACTTCCTTGCAAACCAACCA
    CCTGTTAAAGCGATGACAGAGGCAGCACCTAAAATTATTCATTTATTAGACCGTATGGGT
    GTAATGTTCAATAGAACAAATGAAGGTCTATTAGATTTTAGACGTTTCGGTGGTACATTA
    CACCACAGAACAGCATATGCAGGGGCAACAACTGGACAACAATTATTATATGCATTGGAT
    GAACAAGTTCGTGCATATGAAGTAGATGGATTAGTTACGAAGTATGAAGGATGGGAATTT
    CTTGGCATAGTTAAAGGTGACGATGATAGTGCAAGAGGTATCGTTGCACAAAATATGACA
    ACTGCTGAGATTGAAACATTTGGTTCAGATGCAGTTATTATGGCAACGGGTGGCCCTGGT
    ATTATTTTCGGTAAAACAACAAACTCAATGATTAATACAGGATCAGCGGCTTCCATTGTT
    TACCAACAAGGCGCTATTTATGCTAATGGTGAGTTCATTCAAATTCATCCTACTGCAATC
    CCTGGTGATGATAAACTGCGACTAATGAGTGAATCAGCACGTGGTGAAGGTGGACGAATT
    TGGACATATAAAGATGGTAAGCCTTGGTACTTCTTAGAAGAGAAATATCCTGATTATGGT
    AACTTAGTACCTCGTGATATCGCAACGCGTGAAATTTTCGATGTATGTATTAACCAAAAA
    TTAGGTATAAATGGCGAAAACATGGTATATCTTGATTTGTCACATAAAGATCCACATGAG
    TTAGATGTAAAACTAGGTGGTATCATTGAAATTTATGAAAAATTCACTGGTGATGACCCA
    CGCAAAGTACCAATGAAGATTTTCCCAGCTGTTCACTATTCAATGGGTGGTCTATATGTA
    GATTATGATCAAATGACAAATATTAAAGGGTTATTTGCAGCTGGAGAATGTGACTTCTCT
    CAACATGGTGGTAACCGCTTAGGTGCCAATTCATTGTTATCAGCGATTTATGGTGGTACA
    GTAGCAGGTCCAAACGCGATTGATTATATTTCAAATATTGATCGATCATATACTGATATG
    GACGAAAGTATTTTTGAAAAACGTAAAGCTGAAGAGCAAGAACGTTTTGATAAATTATTA
    GCTATGCGCGGTACAGAAAATGCCTATAAATTACACCGTGAACTTGGTGAAATTATGACA
    GCAAATGTAACTGTTGTTCGTGAAAATGAAAAACTGTTAGAAACAGATAAAAAGATTGTT
    GAATTGATGAAACGTTATGAAGATATTGATATGGAAGATACTCAAACTTGGAGTAACCAA
    GCGGTATTCTTTACCCGTCAACTATGGAACATGTTAGTACTTGCACGTGTTATTACGATT
    GGTGCATATAACCGTAACGAATCACGCGGTGCCCATTATAAACCAGAATTCCCAGAGCGT
    AATGATGAAGAGTGGTTAAAAACGACAATGGCCTCATTCCAAGGCGCATTTGAAAAACCA
    CAGTTTACTTATGATGACGTCGATGTGAGTTTAATACCACCTCGTAAACGTGATTACACA
    AGTAAGTCTAAAGGGGGTAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1767

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS05640 [old locus tag: SA0995 ]
  • symbol: SA_RS05640
  • description: succinate dehydrogenase flavoprotein subunit
  • length: 588
  • theoretical pI: 5.3235
  • theoretical MW: 65502.6
  • GRAVY: -0.398129

Function[edit | edit source]

  • reaction:
    EC 1.3.5.1?  ExPASy
    Succinate dehydrogenase (quinone) Succinate + a quinone = fumarate + a quinol
  • TIGRFAM:
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 970.9)
    and 25 more
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 364.7)
    fumarate reductase (quinol), flavoprotein subunit (TIGR01176; EC 1.3.5.4; HMM-score: 333.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 274.9)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 119)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 19.5)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 17.2)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylylsulfate reductase, alpha subunit (TIGR02061; EC 1.8.99.2; HMM-score: 15.5)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 14.3)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 14.2)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 14.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin 3B synthase CobZ (TIGR02485; HMM-score: 14.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 13.7)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 13.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 12.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 12.7)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 12.5)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 11.7)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 11.3)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 11.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 10.9)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 10.2)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 9.6)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_2; FAD binding domain (PF00890; HMM-score: 283.8)
    and 8 more
    no clan defined Succ_DH_flav_C; Fumarate reductase flavoprotein C-term (PF02910; HMM-score: 141.3)
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 24)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 19.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 18.5)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 14.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 14.3)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 14)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 13)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 22 aa
    • SP(Sec/SPI): 0.583697
    • TAT(Tat/SPI): 0.035658
    • LIPO(Sec/SPII): 0.011556
    • Cleavage Site: CS pos: 22-23. IKA-AE. Pr: 0.4744
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446741022 NCBI
  • RefSeq: WP_000818278 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MAEKHLIVVGGGLAGLMSTIKAAEKGAHVDLFSVVPVKRSHSVCAQGGINGAVNTKGEGDSPWIHFDDTVYGGDFLANQPPVKAMTEAAPKIIHLLDRMGVMFNRTNEGLLDFRRFGGTLHHRTAYAGATTGQQLLYALDEQVRAYEVDGLVTKYEGWEFLGIVKGDDDSARGIVAQNMTTAEIETFGSDAVIMATGGPGIIFGKTTNSMINTGSAASIVYQQGAIYANGEFIQIHPTAIPGDDKLRLMSESARGEGGRIWTYKDGKPWYFLEEKYPDYGNLVPRDIATREIFDVCINQKLGINGENMVYLDLSHKDPHELDVKLGGIIEIYEKFTGDDPRKVPMKIFPAVHYSMGGLYVDYDQMTNIKGLFAAGECDFSQHGGNRLGANSLLSAIYGGTVAGPNAIDYISNIDRSYTDMDESIFEKRKAEEQERFDKLLAMRGTENAYKLHRELGEIMTANVTVVRENEKLLETDKKIVELMKRYEDIDMEDTQTWSNQAVFFTRQLWNMLVLARVITIGAYNRNESRGAHYKPEFPERNDEEWLKTTMASFQGAFEKPQFTYDDVDVSLIPPRKRDYTSKSKGGKK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]