Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS06885 [old locus tag: SA1212 ]
- pan locus tag?: SAUPAN003785000
- symbol: SA_RS06885
- pan gene symbol?: nikD
- synonym: opp2D
- product: peptide ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGAGTCTCATTGATATACAAAATTTAACAATAAAGAATACTTGTGAGAAATATCTTATT
AAAGGGATTGATTTGAAAATTTTTAGTCAACAGATTAATGCCTTGATTGGAGAGAGCGGC
GCTGGGAAAAGTTTGATTGCTAAAGCCTTACTTGAATATTTACCATTTGATTTAAGCTGC
ACGTATGATTCGTACCAATTTGATGGAGAAAATATTAGTAGATTGAGTCAATATTATGGT
CATACAATTGGTTATATTTCTCAAAATTATGCAGAAAGTTTTAACGACCATACTAAATTA
GGTAAACAGTTAACTGCGATTTATCGTAAGCATTATAAAAGTAGTAAAGAAGAGGCTTTG
TCAAAAATTGACAAGGCTTTGTCGTGGGTTAATTTACAAAGCAAAGATATATTAAATAAA
TATAGTTTCCAACTTTCTGGGGGCCAACTTGAACGCGTTTACATAGCAAGCGTTCTCATG
TTGGAGCCTAAATTAATCATTGCAGACGAACCAGTTGCATCATTGGATGCTTTGAACGGT
AATCAAGTGATGGATTTATTACAGCATATTGTATTAGAACATGGTCAAACATTATTTATT
ATCACACATAACTTAAGTCATGTATTGAAATATTGTCAGTACATTTATGTTTTAAAAGAA
GGTCAAATCATTGAACGAGGTAATATTAATCATTTCAAGTATGAGCATTTGCATCCGTAT
ACTGAACGTCTAATTAAATATAGAACACAATTAAAGAGGGATTACTATGATTGA60
120
180
240
300
360
420
480
540
600
660
720
774
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS06885 [old locus tag: SA1212 ]
- symbol: SA_RS06885
- description: peptide ABC transporter ATP-binding protein
- length: 257
- theoretical pI: 7.69261
- theoretical MW: 29698.8
- GRAVY: -0.28249
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 169.9)and 73 moreTransport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 124.8)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 124.5)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 116.2)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 102.8)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 102.8)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 99.5)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 98.3)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 87.1)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 87.1)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 85.8)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 84.9)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 84.5)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 84.2)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 82.6)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 81.3)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 81.3)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 80.3)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 78.8)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 73.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 73.2)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 71.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 71.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 71.2)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 70.5)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 70.5)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 70.4)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 69.8)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 68.7)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 68.2)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 67.3)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 66.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 66.1)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 65.6)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 65.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 65.6)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 64.8)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 64.7)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 64.4)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 64.3)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 62.4)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 62.2)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 61.9)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 61.9)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 61.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 61.9)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 61.9)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 61.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 61.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 61.3)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 61.3)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 58.3)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 57.3)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 55.8)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 55.6)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 55.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 53)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 52.8)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 50.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 48.3)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 42.3)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 42.3)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 40.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 39.1)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 35)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 30.9)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 29)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 27.2)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 19.4)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 19.4)DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 16.1)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 13.2)Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 12.4)
- TheSEED: see SA1212
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 78.9)and 13 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 26.4)AAA_16; AAA ATPase domain (PF13191; HMM-score: 19.9)AAA_22; AAA domain (PF13401; HMM-score: 19)AAA_13; AAA domain (PF13166; HMM-score: 18.4)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 15)Glyco_hydro_tim (CL0058) Glyco_hydro_18; Glycosyl hydrolases family 18 (PF00704; HMM-score: 14.5)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 14.3)AAA_23; AAA domain (PF13476; HMM-score: 14)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 13.7)no clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 12.8)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.7)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.4)APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 12.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.008211
- TAT(Tat/SPI): 0.000388
- LIPO(Sec/SPII): 0.000749
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSLIDIQNLTIKNTCEKYLIKGIDLKIFSQQINALIGESGAGKSLIAKALLEYLPFDLSCTYDSYQFDGENISRLSQYYGHTIGYISQNYAESFNDHTKLGKQLTAIYRKHYKSSKEEALSKIDKALSWVNLQSKDILNKYSFQLSGGQLERVYIASVLMLEPKLIIADEPVASLDALNGNQVMDLLQHIVLEHGQTLFIITHNLSHVLKYCQYIYVLKEGQIIERGNINHFKYEHLHPYTERLIKYRTQLKRDYYD
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.