From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS09280 [old locus tag: SAtRNA20 ]
  • pan locus tag?: SAUPAN004747000
  • symbol: SA_RS09280
  • pan gene symbol?: trnaE
  • synonym:
  • product: tRNA-Glu

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: tRNA
  • locus tag: SA_RS09280 [old locus tag: SAtRNA20 ]
  • symbol: SA_RS09280
  • product: tRNA-Glu
  • replicon: chromosome
  • strand: -
  • coordinates: 1881990..1882061
  • length: 72
  • essential: unknown

⊟Accession numbers[edit | edit source]

  • Location: NC_002745 (1881990..1882061) NCBI
  • BioCyc: SA_RS09280 BioCyc
  • MicrobesOnline: see SAtRNA20

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    GGCTCCTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAGTC
    CCGTAGGAGTCA
    60
    72


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SA_RS09280 [old locus tag: SAtRNA20 ]
  • symbol: SA_RS09280
  • description: tRNA-Glu
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]


⊟Relevant publications[edit | edit source]