From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS10710 [old locus tag: SA1866 ]
  • pan locus tag?: SAUPAN005311000
  • symbol: SA_RS10710
  • pan gene symbol?: ilvA2
  • synonym:
  • product: L-threonine dehydratase biosynthetic IlvA

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS10710 [old locus tag: SA1866 ]
  • symbol: SA_RS10710
  • product: L-threonine dehydratase biosynthetic IlvA
  • replicon: chromosome
  • strand: +
  • coordinates: 2107052..2108320
  • length: 1269
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (2107052..2108320) NCBI
  • BioCyc: G1G21-2164 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACAGTCAAAACAACAGTTTCTACGAAAGATATCGATGAAGCATTTTTAAGACTTAAA
    GATATTGTCAAAGAAACACCTTTACAATTAGACCATTACTTATCTCAAAAGTATGATTGT
    AAAGTTTATTTAAAACGAGAAGATTTACAATGGGTACGTTCTTTTAAATTAAGAGGTGCT
    TACAACGCTATTTCTGTTTTATCAGATGAAGCTAAAAGTAAAGGTATTACATGTGCGAGT
    GCAGGTAATCATGCTCAAGGTGTTGCCTATACAGCTAAAAAACTTAATTTAAACGCTGTT
    ATCTTTATGCCAGTCACTACACCTTTACAAAAGGTAAATCAAGTAAAGTTCTTTGGAAAT
    AGTAACGTTGAAGTTGTACTCACTGGTGATACATTTGATCACTGTTTAGCTGAAGCTTTA
    ACTTATACAAGTGAACATCAAATGAACTTTATAGATCCATTCAATAATGTTCATACAATT
    TCTGGACAAGGTACGCTTGCTAAAGAAATGCTAGAACAATCAAAGACTGACAATGTTAAC
    TTTGATTATTTATTTGCCGCTATTGGTGGTGGTGGATTAATTTCAGGTATTAGTACTTAC
    TTTAAAACCTATTCACCTACTACGAAAATTATAGGTGTTGAACCTTCAGGTGCAAGTAGT
    ATGTATGAATCTGTTGTCGTAAATAATCAGGTAGTCACATTGCCTAATATCGATAAATTT
    GTGGACGGTGCATCTGTAGCTAGAGTTGGCGATATTACATTTGAAATTGCAAAAGAAAAT
    GTAGATGATTACGTTCAAGTAGATGAAGGTGCAGTTTGTTCTACGATTTTAGACATGTAT
    TCAAAACAAGCAATTGTAGCAGAACCTGCTGGCGCATTAAGTGTGAGTGCTCTTGAAAAC
    TACAAAGACCACATTATGGGTAAAACTGTTGTTTGTGTCATTAGTGGTGGTAATAATGAT
    ATTAATCGTATGAAGGAAATTGAAGAACGTTCTTTATTATATGAAGAAATGAAACATTAT
    TTTATTTTAAACTTCCCTCAACGCCCTGGTGCATTAAGAGAATTTGTAAATGATGTTTTA
    GGCCCACAAGACGATATTACAAAATTTGAATACTTAAAAAAATCTTCTCAAAATACAGGT
    ACTGTCATTATTGGTATTCAACTTAAAGATCATGATGATTTAATACAACTCAAACAACGT
    GTAAATCATTTCGATCCTTCCAATATTTATATTAATGAAAATAAGATGTTATATTCATTG
    TTAATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1269

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS10710 [old locus tag: SA1866 ]
  • symbol: SA_RS10710
  • description: L-threonine dehydratase biosynthetic IlvA
  • length: 422
  • theoretical pI: 5.29667
  • theoretical MW: 46970.1
  • GRAVY: -0.175118

Function[edit | edit source]

  • reaction:
    EC 4.3.1.19?  ExPASy
    Threonine ammonia-lyase L-threonine = 2-oxobutanoate + NH3
  • TIGRFAM:
    Metabolism Amino acid biosynthesis Pyruvate family threonine dehydratase (TIGR02079; EC 4.3.1.19; HMM-score: 613.5)
    and 16 more
    Metabolism Amino acid biosynthesis Pyruvate family threonine ammonia-lyase, biosynthetic (TIGR01124; EC 4.3.1.19; HMM-score: 360.8)
    Metabolism Amino acid biosynthesis Pyruvate family threonine ammonia-lyase (TIGR01127; EC 4.3.1.19; HMM-score: 306.6)
    ectoine utilization protein EutB (TIGR02991; HMM-score: 192)
    Metabolism Amino acid biosynthesis Serine family cysteine synthase (TIGR01136; EC 2.5.1.47; HMM-score: 64.3)
    Metabolism Amino acid biosynthesis Serine family cysteine synthase A (TIGR01139; EC 2.5.1.47; HMM-score: 62.2)
    Cellular processes Cellular processes Biosynthesis of natural products 2,3-diaminopropionate biosynthesis protein SbnA (TIGR03945; HMM-score: 61.7)
    Metabolism Amino acid biosynthesis Aspartate family threonine synthase (TIGR00260; EC 4.2.3.1; HMM-score: 59.1)
    diaminopropionate ammonia-lyase (TIGR03528; EC 4.3.1.15; HMM-score: 58.8)
    Metabolism Energy metabolism Other diaminopropionate ammonia-lyase family (TIGR01747; EC 4.3.1.15; HMM-score: 57)
    Metabolism Amino acid biosynthesis Aromatic amino acid family tryptophan synthase, beta subunit (TIGR00263; EC 4.2.1.20; HMM-score: 49.5)
    pyridoxal phosphate-dependent enzymes, D-cysteine desulfhydrase family (TIGR01275; HMM-score: 47.8)
    Metabolism Amino acid biosynthesis Serine family cystathionine beta-synthase (TIGR01137; EC 4.2.1.22; HMM-score: 42.4)
    Metabolism Amino acid biosynthesis Serine family cysteine synthase B (TIGR01138; EC 2.5.1.47; HMM-score: 38.5)
    Unknown function Enzymes of unknown specificity pyridoxal-phosphate dependent TrpB-like enzyme (TIGR01415; HMM-score: 17.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 15.9)
    Metabolism Energy metabolism Methanogenesis cysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 15.9)
  • TheSEED:
  • PFAM:
    no clan defined PALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 241.9)
    and 3 more
    ACT (CL0070) Thr_dehydrat_C; C-terminal regulatory domain of Threonine dehydratase (PF00585; HMM-score: 75.1)
    TIM_barrel (CL0036) SOR_SNZ; SOR/SNZ family (PF01680; HMM-score: 12.3)
    PP-binding (CL0314) Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 12.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003093
    • TAT(Tat/SPI): 0.000251
    • LIPO(Sec/SPII): 0.000423
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446139001 NCBI
  • RefSeq: WP_000216856 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTVKTTVSTKDIDEAFLRLKDIVKETPLQLDHYLSQKYDCKVYLKREDLQWVRSFKLRGAYNAISVLSDEAKSKGITCASAGNHAQGVAYTAKKLNLNAVIFMPVTTPLQKVNQVKFFGNSNVEVVLTGDTFDHCLAEALTYTSEHQMNFIDPFNNVHTISGQGTLAKEMLEQSKTDNVNFDYLFAAIGGGGLISGISTYFKTYSPTTKIIGVEPSGASSMYESVVVNNQVVTLPNIDKFVDGASVARVGDITFEIAKENVDDYVQVDEGAVCSTILDMYSKQAIVAEPAGALSVSALENYKDHIMGKTVVCVISGGNNDINRMKEIEERSLLYEEMKHYFILNFPQRPGALREFVNDVLGPQDDITKFEYLKKSSQNTGTVIIGIQLKDHDDLIQLKQRVNHFDPSNIYINENKMLYSLLI

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]