Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS12615 [old locus tag: SA2200 ]
- pan locus tag?: SAUPAN005946000
- symbol: SA_RS12615
- pan gene symbol?: tcyC
- synonym:
- product: amino acid ABC transporter ATP-binding protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA_RS12615 [old locus tag: SA2200 ]
- symbol: SA_RS12615
- product: amino acid ABC transporter ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 2469373..2470104
- length: 732
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGATTCAATTGAACAATATCCATAAATCATTTAATGATGTTGAAGTCATCAAAGGTATT
GATTTATCTGTTGAACAAGGTGAGGTTGTAACCTTAATCGGTCGATCTGGTTCAGGTAAA
ACAACATTGTTACGTATGATTAATGCATTAGAAATTCCAACTGAAGGTACAGTTTATGTT
AACGGCAAAACATATACATCTAAAGATAAAAAATCACAAATAGAAGTTCGTAAACAGTCT
GGCATGGTATTTCAAAGTTATAACCTTTTTCCGCATAAGACGGCATTAGAAAATGTAATG
GAAGGTCTTATCACAGTTAAAAAGTTGAAAAAGGATGAGGCACGTGGGAAATCACTTGAG
TTACTTGAGAAAGTTGGTTTAACACATGTCAAAGATCAACGTCCACATGCATTATCAGGT
GGTCAACAACAACGTGTTGCTATTGCAAGAGCACTAGCAATGAACCCTAAAGTGATGTTG
TTTGATGAACCAACATCTGCACTTGATCCTGAACTTGTGAATGATGTTTTAAAGGTTATT
AAAGATTTGGCTAATGAAGGCATGACAATGGTCATTGTGACACATGAAATGCGTTTTGCA
AAAGAAGTATCTAATAACATTGTATTTATTCATGAAGGCATGATCGGAGAACAAGGGGCT
CCAGAAGAGATGTTCAATCGTCCGAAAACAGAAGAATTAAGACGTTTCTTAAATGTTATA
AATGAAGAATAA60
120
180
240
300
360
420
480
540
600
660
720
732
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS12615 [old locus tag: SA2200 ]
- symbol: SA_RS12615
- description: amino acid ABC transporter ATP-binding protein
- length: 243
- theoretical pI: 7.18777
- theoretical MW: 27241.3
- GRAVY: -0.311111
⊟Function[edit | edit source]
- TIGRFAM: ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 280.4)and 80 moreTransport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 221.3)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 216)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 214.1)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 207.1)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 204.4)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 201.3)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 194.4)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 190.3)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 189.8)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 189.8)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 185.2)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 183.7)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 181.7)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 173.8)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 165.9)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 165.2)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 163.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 160.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 160.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 156.5)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 156.5)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 152.3)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 152.1)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 150.5)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 143.1)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 143.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 133.7)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 133.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 132.8)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 132.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 132.2)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 132)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 126.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 124.2)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 122.8)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 121.8)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 118.8)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 117.5)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 114.8)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 114.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 114.3)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 114.3)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 113.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 112.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 112.7)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 111.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 108.9)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 107.6)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 107.6)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 106.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 102.2)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 95.4)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 95.4)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 87.2)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 85.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 83.1)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 82.7)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 82.7)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 76.8)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 76.8)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 59.8)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 57.2)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.3)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 48.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 42)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 16.3)Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 15.5)DNA repair and recombination protein RadB (TIGR02237; HMM-score: 15.4)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 14.4)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 14)rad50 (TIGR00606; HMM-score: 13.3)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 12.9)Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 12.2)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12.1)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 11.1)
- TheSEED: see SA2200
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 137.5)and 33 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 46.7)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 33.6)AAA_13; AAA domain (PF13166; HMM-score: 29.8)AAA_22; AAA domain (PF13401; HMM-score: 23.5)ABC_ATPase; P-loop domain (PF09818; HMM-score: 20.8)AAA_15; AAA ATPase domain (PF13175; HMM-score: 20.8)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 19.5)AAA_16; AAA ATPase domain (PF13191; HMM-score: 18.6)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 18.4)AAA_14; AAA domain (PF13173; HMM-score: 18.4)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 18.1)PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 17)NB-ARC; NB-ARC domain (PF00931; HMM-score: 16.9)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.8)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.1)AAA_23; AAA domain (PF13476; HMM-score: 16)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.5)AAA_30; AAA domain (PF13604; HMM-score: 15.5)NACHT; NACHT domain (PF05729; HMM-score: 15.1)MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 14.4)AAA_19; AAA domain (PF13245; HMM-score: 14.4)AAA_24; AAA domain (PF13479; HMM-score: 14.2)ORC-CDC6-like; ORC-CDC6-like (PF24389; HMM-score: 14.2)AAA_25; AAA domain (PF13481; HMM-score: 13.8)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 13.5)HTH (CL0123) DUF3161; Protein of unknown function (DUF3161) (PF11362; HMM-score: 13.5)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.2)AAA_33; AAA domain (PF13671; HMM-score: 12.6)cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 12.4)AAA_28; AAA domain (PF13521; HMM-score: 12.4)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.2)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.2)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 12)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1433
- Cytoplasmic Membrane Score: 0.7915
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.065
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.005078
- TAT(Tat/SPI): 0.000687
- LIPO(Sec/SPII): 0.000465
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIQLNNIHKSFNDVEVIKGIDLSVEQGEVVTLIGRSGSGKTTLLRMINALEIPTEGTVYVNGKTYTSKDKKSQIEVRKQSGMVFQSYNLFPHKTALENVMEGLITVKKLKKDEARGKSLELLEKVGLTHVKDQRPHALSGGQQQRVAIARALAMNPKVMLFDEPTSALDPELVNDVLKVIKDLANEGMTMVIVTHEMRFAKEVSNNIVFIHEGMIGEQGAPEEMFNRPKTEELRRFLNVINEE
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA_RS05360 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CymR* see SA2200
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)