From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13685 [old locus tag: SA2391 ]
  • pan locus tag?: SAUPAN006292000
  • symbol: SA_RS13685
  • pan gene symbol?: panC
  • synonym:
  • product: pantoate--beta-alanine ligase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS13685 [old locus tag: SA2391 ]
  • symbol: SA_RS13685
  • product: pantoate--beta-alanine ligase
  • replicon: chromosome
  • strand: -
  • coordinates: 2679036..2679887
  • length: 852
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (2679036..2679887) NCBI
  • BioCyc: G1G21-2781 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACTAAGCTGATTACTACGGTAAAAGAGATGCAACACATTGTTAAAGCAGCCAAACGC
    TCAGGAACAACGATTGGTTTTATCCCAACAATGGGTGCCTTACATGATGGACATTTAACG
    ATGGTACGCGAATCAGTTAGTACAAATGATATTACAGTTGTGAGTGTATTTGTTAATCCA
    TTACAATTTGGTCCAAACGAAGATTTCGATGCTTATCCGAGACAAATTGATAAAGATTTA
    GAATTAGTATCAGAAGTAGGGGCGGACATTGTTTTTCATCCTGCAGTAGAAGATATATAT
    CCAGGTGAATTAGGTATTGATGTCAAAGTAGGTCCATTAGCTGATGTGTTAGAAGGAGCG
    AAGCGTCCAGGGCATTTTGATGGGGTGGTAACAGTAGTTAATAAGCTATTTAATATTGTT
    ATGCCGGATTATGCTTATTTTGGTAAAAAAGATGCCCAGCAATTGGCTATTGTCGAGCAA
    ATGGTAAAAGACTTCAATCATGCCGTTGAAATTATTGGTATTGATATCGTTCGAGAAGCA
    GATGGTTTGGCGAAAAGTTCAAGAAATGTTTATTTAACGGAGCAAGAACGACAAGAAGCG
    GTACATTTAAGTAAAAGTTTGCTATTAGCACAAGCGTTGTATCAAGACGGTGAACGTCAA
    AGTAAAGTAATTATAGACAGGGTTACTGAATATCTTGAATCACATATAAGTGGACGCATT
    GAAGAAGTTGCTGTTTATAGTTATCCTCAATTAGTAGAACAACACGAAATAACTGGACGC
    ATATTTATCTCGTTAGCTGTCAAATTTTCAAAAGCGCGTTTAATAGATAATATAATAATT
    GGAGCTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    852

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS13685 [old locus tag: SA2391 ]
  • symbol: SA_RS13685
  • description: pantoate--beta-alanine ligase
  • length: 283
  • theoretical pI: 4.95781
  • theoretical MW: 31429.8
  • GRAVY: -0.0127208

Function[edit | edit source]

  • reaction:
    EC 6.3.2.1?  ExPASy
    Pantoate--beta-alanine ligase (AMP-forming) ATP + (R)-pantoate + beta-alanine = AMP + diphosphate + (R)-pantothenate
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A pantoate--beta-alanine ligase (TIGR00018; EC 6.3.2.1; HMM-score: 344.3)
    and 1 more
    cytidyltransferase-like domain (TIGR00125; HMM-score: 27.3)
  • TheSEED:
  • PFAM:
    HUP (CL0039) Pantoate_ligase; Pantoate-beta-alanine ligase (PF02569; HMM-score: 327.7)
    and 1 more
    Pec_lyase-like (CL0268) Haemagg_act; haemagglutination activity domain (PF05860; HMM-score: 12.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.013361
    • TAT(Tat/SPI): 0.001038
    • LIPO(Sec/SPII): 0.0019
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446085882 NCBI
  • RefSeq: WP_000163737 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTKLITTVKEMQHIVKAAKRSGTTIGFIPTMGALHDGHLTMVRESVSTNDITVVSVFVNPLQFGPNEDFDAYPRQIDKDLELVSEVGADIVFHPAVEDIYPGELGIDVKVGPLADVLEGAKRPGHFDGVVTVVNKLFNIVMPDYAYFGKKDAQQLAIVEQMVKDFNHAVEIIGIDIVREADGLAKSSRNVYLTEQERQEAVHLSKSLLLAQALYQDGERQSKVIIDRVTEYLESHISGRIEEVAVYSYPQLVEQHEITGRIFISLAVKFSKARLIDNIIIGAE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]