From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS14370
  • pan locus tag?:
  • symbol: SA_RS14370
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS, pseudogene
  • locus tag: SA_RS14370
  • symbol: SA_RS14370
  • product: hypothetical protein
  • replicon: pN315
  • strand: -
  • coordinates: 3521..3753
  • length: 233
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_003140 (3521..3753) NCBI
  • BioCyc: G1G21-2913 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    TTGAATTTTAAGAGGGCATTTTAAAGATTTAGGGGTGATTCATATAGTTTTATATCTAAA
    ACTTATATATGCTTTTAAAACGCAAATATGAGCCAAATAAATATATGCTATTTTCAAAAA
    CAAAAATTTGAGCAAAAACAATAACTATTTTTAGACACTGCCCATTTACATGCAAATTAA
    AAATTAGCATAAAATTCTTTAAAACTTCCCCACGTTTTTCTAAATTCCTGTAG
    60
    120
    180
    233

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS14370
  • symbol: SA_RS14370
  • description: hypothetical protein
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]