From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06105 [old locus tag: NWMN_1077 ]
  • pan locus tag?: SAUPAN003428000
  • symbol: NWMN_RS06105
  • pan gene symbol?: ssl14
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06105 [old locus tag: NWMN_1077 ]
  • symbol: NWMN_RS06105
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1180425..1181150
  • length: 726
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1180425..1181150) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAAAGAACATCATGAATAAATTAGTTTTATCAACAGCATTGTTACTTTTAGAAACT
    ACATCAACACAACTTCCTAAAACACCAATCAGTTTTTCATCTGAAGCAAAAGCCTATAAT
    ATCAGTGAAAACGAGACTAATATCAATGAACTAATCAAATATTACACTCAGCCGCATTTT
    TCATTATCTGGAAAATGGTTATGGCAAAAGCCCAATGGTAGCATTCATGCAACATTGCAA
    ACGTGGGTTTGGTATAGTCATATTCAAGTGTTTGGATCCGAGAGTTGGGGAAACATTAAT
    CAGTTAAGAAATAAATACGTTGATATATTTGGAACTAAAGATGAGGACACAGTTGAAGGT
    TACTGGACTTATGATGAAACATTTACTGGTGGTGTTACGCCAGCAGCTACTTCATCTGAT
    AAGCCTTATAGACTATTTTTAAAATATAGTGATAAACAACAAACTATCATCGGTGGACAT
    GAATTTTACAAAGGAAATAAACCAGTATTAACTTTAAAAGAATTAGATTTCCGTATTCGT
    CAAACATTAATAAAAAATAAAAAGTTATATAACGGAGAATTTAATAAAGGTCAAATTAAG
    ATAACTGCTGATGGAAATAATTACACGATTGATTTAAGTAAAAAGTTAAAATTAACTGAC
    ACAAACCGTTATGTTAAAAATCCTCGTAATGCAGAAATTGAAGTCATACTCGAAAAATCT
    AACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    726

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06105 [old locus tag: NWMN_1077 ]
  • symbol: NWMN_RS06105
  • description: hypothetical protein
  • length: 241
  • theoretical pI: 9.74236
  • theoretical MW: 27794.3
  • GRAVY: -0.641079

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    Ant-toxin_C (CL0386) Stap_Strp_tox_C; Staphylococcal/Streptococcal toxin, beta-grasp domain (PF02876; HMM-score: 32.5)
    no clan definedDicty_CAD; Cell-cell adhesion domain (PF05720; HMM-score: 13.8)
    Lsr2; Lsr2 (PF11774; HMM-score: 13.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.01
    • Extracellular Score: 9.98
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide length 27 aa
    • Ymax: 0.295
    • Ymax_pos: 27
    • Cmax: 0.158
    • Cmax_pos: 34
    • Smax: 0.906
    • Smax_pos: 7
    • Smean: 0.761
    • D: 0.477
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446662177 NCBI
  • RefSeq: WP_000739523 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKNIMNKLVLSTALLLLETTSTQLPKTPISFSSEAKAYNISENETNINELIKYYTQPHFSLSGKWLWQKPNGSIHATLQTWVWYSHIQVFGSESWGNINQLRNKYVDIFGTKDEDTVEGYWTYDETFTGGVTPAATSSDKPYRLFLKYSDKQQTIIGGHEFYKGNKPVLTLKELDFRIRQTLIKNKKLYNGEFNKGQIKITADGNNYTIDLSKKLKLTDTNRYVKNPRNAEIEVILEKSN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06105 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]