From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS10840 [old locus tag: NWMN_1884 ]
  • pan locus tag?: SAUPAN005041000
  • symbol: NWMN_RS10840
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS10840 [old locus tag: NWMN_1884 ]
  • symbol: NWMN_RS10840
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2095391..2095765
  • length: 375
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2095391..2095765) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    TTGGATGATATTCAGAAAATAAAAAAAGAGCTTTCTGAATTAGTTGAACGTGTGGATGAT
    GTTGAAATACTAGCAAATGAAACAGCTGATCATGTGCTTGAACTTAGAGAGGAACATAAG
    CAACATCATAATGAACTAAGAGAATCTCATAAAGAACTTAAAGATAAGCAAGATAAAGTT
    GTAGATGAGAATTTAGAGCAAACAAAGATATTAAACAGAATTGAAGAAAGATATCAAACG
    CAAGTAGATGTTGCGCAAAAAAACGAAGAAAAGACACTCGCCCAAAATAAATGGCTCGTA
    GGTGCCATATGGGCGCTTGTAACAATTGTTATGATTGCAGTCATTACTGCATCAATTACT
    GCGTTATTACCTTAA
    60
    120
    180
    240
    300
    360
    375

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS10840 [old locus tag: NWMN_1884 ]
  • symbol: NWMN_RS10840
  • description: hypothetical protein
  • length: 124
  • theoretical pI: 4.77438
  • theoretical MW: 14429.3
  • GRAVY: -0.557258

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    SH3 domain protein (TIGR04211; HMM-score: 17)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processingProtein synthesistRNA aminoacylationserine--tRNA ligase (TIGR00414; EC 6.1.1.11; HMM-score: 9)
  • TheSEED:
  • PFAM:
    no clan definedPHA_synth_III_E; Poly(R)-hydroxyalkanoic acid synthase subunit (PHA_synth_III_E) (PF09712; HMM-score: 18.4)
    CheZ; Chemotaxis phosphatase, CheZ (PF04344; HMM-score: 16.6)
    Ion_channel (CL0030) Lig_chan; Ligand-gated ion channel (PF00060; HMM-score: 14.4)
    no clan definedSpt5_N; Spt5 transcription elongation factor, acidic N-terminal (PF11942; HMM-score: 14.3)
    US6; Viral unique short region 6 (PF17616; HMM-score: 13.4)
    YtxH; YtxH-like protein (PF12732; HMM-score: 13.3)
    DAG1; Dystroglycan (Dystrophin-associated glycoprotein 1) (PF05454; HMM-score: 12.8)
    TMPIT; TMPIT-like protein (PF07851; HMM-score: 11.8)
    GST_C (CL0497) GST_C; Glutathione S-transferase, C-terminal domain (PF00043; HMM-score: 11.1)
    no clan definedDHHA1; DHHA1 domain (PF02272; HMM-score: 11)
    TPR_MLP1_2; TPR/MLP1/MLP2-like protein (PF07926; HMM-score: 10.8)
    DUF724; Protein of unknown function (DUF724) (PF05266; HMM-score: 10.7)
    zf-C4H2; Zinc finger-containing protein (PF10146; HMM-score: 9.7)
    V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 8.6)
    YjbJ-CsbD-like (CL0406) DUF883; Bacterial protein of unknown function (DUF883) (PF05957; HMM-score: 8.1)
    no clan definedFib_alpha; Fibrinogen alpha/beta chain family (PF08702; HMM-score: 6.3)
    DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 6.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.112
    • Ymax_pos: 41
    • Cmax: 0.101
    • Cmax_pos: 41
    • Smax: 0.158
    • Smax_pos: 38
    • Smean: 0.084
    • D: 0.101
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446263122 NCBI
  • RefSeq: WP_000340977 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MDDIQKIKKELSELVERVDDVEILANETADHVLELREEHKQHHNELRESHKELKDKQDKVVDENLEQTKILNRIEERYQTQVDVAQKNEEKTLAQNKWLVGAIWALVTIVMIAVITASITALLP

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS10840 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]