From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1818 [new locus tag: SA_RS10440 ]
  • pan locus tag?: SAUPAN005244000
  • symbol: SA1818
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1818 [new locus tag: SA_RS10440 ]
  • symbol: SA1818
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2059637..2060197
  • length: 561
  • essential: no DEG

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAATAAAAAACTATTAACAAAAACATTGATAGCAAGTGCTTTAGTTTTAACAACAGTA
    GGTTCAGGTTTTCATTCTTCTTCAAATTATAATGGTATTAATAACGTTGCAAAAGCTGAG
    CAAACGACAGATAACGCATTGTGGAAAAATGTAAGAGACGCTTTAAAAGACGCGAATATT
    ATCGATAAAACAGATAATGAAAATGTCAAGGTTACGTATAAAATAGAAAATGGTGGAGAA
    AATACCATAGAAGGAACAGCTAATTTAGAAAATATTAGTACTTCAAACAATCCTAAAATA
    AACCCTCAAAATGTTACAAAAATTAATATAACTAGAAAAAATTCGAACTACCCTAATATT
    GATGCTAATAATACATGGAAAAAATTAACAGAAAAATTGAAAGAAAAAAATATAGTGAAC
    AACGGCGACAATGTTTCAATCTTAAGTACAGACCCTAAAGATGAGACTGTATTCGGTAAA
    GTAGGAGAAGATAAATCAAACGTAAGCAATAGATACATCAATCCTAAAGATATAAATGAA
    ATTCAAATCACTAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    561

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1818 [new locus tag: SA_RS10440 ]
  • symbol: SA1818
  • description: hypothetical protein
  • length: 186
  • theoretical pI: 9.74077
  • theoretical MW: 20605.8
  • GRAVY: -0.82957

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsputative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 20.1)
    Genetic information processingTranscriptionTranscription factorstranscription elongation factor GreA (TIGR01462; HMM-score: 15.2)
  • TheSEED:  
    Phages, Prophages, Transposable elements, PlasmidsPathogenicity islandsStaphylococcal pathogenicity islands SaPI Secreted protein Ear, superantigen-encoding pathogenicity islands SaPI 
  • PFAM:
    no clan definedDUF4888; Domain of unknown function (DUF4888) (PF16229; HMM-score: 66.3)
    PK_C; Pyruvate kinase, alpha/beta domain (PF02887; HMM-score: 16.2)
    Terminase_4; Phage terminase, small subunit (PF05119; HMM-score: 14.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: 2
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide length 33 aa
    • Ymax: 0.353
    • Ymax_pos: 33
    • Cmax: 0.281
    • Cmax_pos: 40
    • Smax: 0.942
    • Smax_pos: 11
    • Smean: 0.784
    • D: 0.521
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKKLLTKTLIASALVLTTVGSGFHSSSNYNGINNVAKAEQTTDNALWKNVRDALKDANIIDKTDNENVKVTYKIENGGENTIEGTANLENISTSNNPKINPQNVTKINITRKNSNYPNIDANNTWKKLTEKLKEKNIVNNGDNVSILSTDPKDETVFGKVGEDKSNVSNRYINPKDINEIQITKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SaeR
    SaeR (TF) important in VirulenceRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]