From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1824 [new locus tag: SA_RS10470 ]
  • pan locus tag?: SAUPAN005222000
  • symbol: SA1824
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1824 [new locus tag: SA_RS10470 ]
  • symbol: SA1824
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2063659..2064237
  • length: 579
  • essential: no DEG

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAAACTGAATCGTACTTTAAAGAATACAACCAATTTGTAATAGATCAACAAAAGGCT
    ATACAAGAATTGGAACAAGAGCGTAATGCATTGGAGAGTAAAATAAAGATAGATAAGTCC
    ACATATAAACAGTTAATCATGGATGGACAAGATGATAAAGCAGATAACCTATATCAAGCA
    ACAGATGCTGATGAAAAGAAACTAAAAGCACTTAATAAACGCTTAGAGACAAAGAAAAGT
    GTGTCGAAAGAAGTTAAATATCAAAAGACAATTGAATTATTAAAACATCAAAGCGAGTTG
    TCATCATTATACGAATCAGAAAAGCAATCAGCTTTAGGTAAATTAAAAAAAGTAGTCGAT
    GCATATAATGAGATCATTGATGAAATAGAAGATATTAATGATAGATATGAAGATGAGCAT
    CAGCAATATGCGAGTATTTATAGTCAAGAACAATTATATGATGATAAAGAGGCTAGGGAA
    GCATTGAATGGCTACTTTAGAGAAAATATATTTACATCATATATTAATGGTAATGATTTG
    CCATACGAACACAATAACAAGTTGTTTTTAAAACGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    579

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1824 [new locus tag: SA_RS10470 ]
  • symbol: SA1824
  • description: hypothetical protein
  • length: 192
  • theoretical pI: 4.85714
  • theoretical MW: 22805.2
  • GRAVY: -1.12292

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    WXG100 family type VII secretion target (TIGR03930; HMM-score: 14.1)
    two transmembrane protein (TIGR04527; HMM-score: 11.1)
    Cellular processesCellular processesCell divisioncell division protein FtsL (TIGR02209; HMM-score: 8.1)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage major capsid protein, HK97 family (TIGR01554; HMM-score: 5.8)
  • TheSEED:  
    Phages, Prophages, Transposable elements, PlasmidsPathogenicity islandsStaphylococcal pathogenicity islands SaPI Hypothetical SAV0796 homolog in superantigen-encoding pathogenicity islands SaPI 
  • PFAM:
    no clan definedCAC1F_C; Voltage-gated calcium channel subunit alpha, C-term (PF16885; HMM-score: 11.9)
    AB_hydrolase (CL0028) BAAT_C; BAAT / Acyl-CoA thioester hydrolase C terminal (PF08840; HMM-score: 11.5)
    no clan definedSlyX; SlyX (PF04102; HMM-score: 10.2)
    DUF16; Protein of unknown function DUF16 (PF01519; HMM-score: 9.9)
    DUF5082; Domain of unknown function (DUF5082) (PF16888; HMM-score: 9.5)
    IncA; IncA protein (PF04156; HMM-score: 9.3)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 9.2)
    no clan definedFlagellin_N; Bacterial flagellin N-terminal helical region (PF00669; HMM-score: 8.7)
    DUF501; Protein of unknown function (DUF501) (PF04417; HMM-score: 8.2)
    Sec2p; GDP/GTP exchange factor Sec2p (PF06428; HMM-score: 6.9)
    CorA; CorA-like Mg2+ transporter protein (PF01544; HMM-score: 5.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.119
    • Ymax_pos: 31
    • Cmax: 0.12
    • Cmax_pos: 55
    • Smax: 0.165
    • Smax_pos: 20
    • Smean: 0.092
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKTESYFKEYNQFVIDQQKAIQELEQERNALESKIKIDKSTYKQLIMDGQDDKADNLYQATDADEKKLKALNKRLETKKSVSKEVKYQKTIELLKHQSELSSLYESEKQSALGKLKKVVDAYNEIIDEIEDINDRYEDEHQQYASIYSQEQLYDDKEAREALNGYFRENIFTSYINGNDLPYEHNNKLFLKR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]