From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2102 [new locus tag: SA_RS12085 ]
  • pan locus tag?: SAUPAN005786000
  • symbol: SA2102
  • pan gene symbol?: fdhA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2102 [new locus tag: SA_RS12085 ]
  • symbol: SA2102
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2362390..2365344
  • length: 2955
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    ATGCAAGAACATTTGGTGGTTACACTTGATGGAAAAGATTATCTTGTAGAACCAGGTACG
    AATTTACTTGAATTTATTAAATCACAAGATACTTTTGTACCTTCAATTTGTTATAACGAG
    TCGATGGGACCAATTCAAACATGTGATACATGTACTGTTGAGATTGACGGTAAAATTGAA
    CGTTCATGTAGTACGGTGATTGATCGTCCAATGACTGTAAATACTGTGAACAATGATGTG
    AAAGATGCTCAAAAAGAAGCGCTTGATCGAATTTTAGAAAAGCATATGCTGTATTGTACA
    GTATGTGATTATAATAATGGTGATTGTGAAATTCATAATACGATGGATGCATGGGGGCTT
    CAGCATCAAACGTATGAATATAAAGAGAAGCCATATGAAAAGGATTATGGCCCATTTTAT
    CGTTATGATCCAAATCAATGTATCTTATGTGGGCGTTGTGTAGAAGCATGTCAAGATATC
    GAAGTGAATGAAACTATTAGAATTGATTGGGATCGTGAACATCCACGTGTTATTTGGGAT
    AATGATGTACCAATTAATGAATCGTCATGTGTATCTTGTGGTCAATGCGCAACTGTATGT
    CCATGTAATGCCATGATGGAAGTGAATATGGAAGGTAATGCGGGTTATATGACTGATACG
    GAACCTGGTTCATTAGCAGCAATGATTGATTTAACTAAAAAAGCAGAACCTGGTTATGGT
    CCACTATTTGCAATCTCAGATTCAGAAGCAGAAATGCGTAAAGAGCGTATTAAGAAAACT
    AAAACAGTGTGTACTTATTGTGGTGTGGGTTGTTCATTTGAAGTTTGGACTAAAGATAGA
    GAAATTTTAAAAGTACAACCATCACATGATTCTCCAGCAAATAAAATTGCGACTTGTGTT
    AAAGGTAAGTTTTCATGGGGACATATTAATTCAGATCAACGCTTAACTAAACCACTAGTA
    AGGAAAAATGGTGAGTTCCATGAAGTAGAATGGGATGAAGCTTTAAATGTCATTGCAGAT
    AATTTTACATCTATTAAAGAAAAGTATGGCCCAGATGCACTATCATTCATTTCTTCTTCT
    AAAGCGACGAATGAAGAATCGTATTTAATGCAAAAATTAGCAAGACAAGTTATTGGCACA
    AATAACGTTGATAACTGTTCAAGATATTGCCAAGCACCTGCAACAAAAGGCTTATTTAGA
    ACGGTTGGACACGGCGGTGACTCAGGTAGTATTGAAGATTTAGAAAAAGCGGCAATGTCT
    GTATTGATAGGTACCAATACAGCCGAAGCTCATCCAGTTATCGCATCACGCATGAAACGT
    GCTCAAAAATTATTTGGACAAAAAATACATGTATTTGATATTAGAAAACATGAAATGGCA
    GAACGTGCGGATCGTTTTTATCAACCTAAACCAGGTACGGATTTAGCGTGGTTAAGTGCA
    GTGACTAAGTATATTATTGATCATGATTTACACGATAAAGCATTTATTGATGAGTGGGTA
    GATGATTTTGATGAATATTACAAATCATTAGAAACATTTACAATGGCTTTTGCTGAAGAA
    GCAACAGGTATTCCTGAATCAGAATTGATTAAATTTGCTGAAGAATGTGCTAAAGCTGAA
    TCTGTTGTAATTTGTTGGGCAATGGGTATTACACAACAAGACATTGGTAGTGACTCAAGT
    ACAGCGATTTCAAACTTATTATTAGTAACAGGTAATTATCGTCGTCCTGGTACTGGTGCG
    TATCCATTACGTGGACATAATAATGTTCAAGGATGTAGTGATATGGGAAGTATGCCTGAT
    AAGATTACTGGTTATCAAAGTATTGAAGCGGATGATATTCGCGCTAAATTTGAAAAAGAA
    TATGGCGTTAAATTGAATCCAAAAGCTGGTAAAGATAATCATGAAATGGTAGAAGGTATA
    CATGACGGAGAAGTACACTCATTGTACTTATATGGTGAAGATACGGGTATTGTGGATTCA
    AATATTAATTTTGTACAAGCTGCGTTTGAAAAATTAGATTTCATGGTAGTCCAAGATGAA
    TTTTTAACATTCACAGCAACATACGCAGATGTTGTATTGCCAGCAAGTCCTTCACTTGAA
    AAAGACGGTACTTTTACAAATACCGAACGTCGTATTCAACGTTTATACCAAGCATTAGAA
    CCTCTTGGTGATTCAAAACCTGACTGGAAAATTTTCCAAGCAATTGCTAATAGATTAGGA
    TTTGATTGGAATTACAAGCATCCTAGTGAAATTATGGATGAAGTAGCACGCTTAACACCT
    CTATATGCTGGGGTAAGTTATGATCGTTTAGAAGGATTCAATAGTTTACAATGGCCAGTA
    CAACCTGATGGTACTGATGAGCCTATTCTATACTTAGAAGGATTCAATTTTGATAATGGT
    AAAGCAAAATTATTCCCATTATCATTTGATAATTACTTTAAGCAAGATGAAATTTATGAT
    ATTCATGTAAACAATGGTCGATTGTTAGAGCACTTCCATGAAGGTAATATGACTTATCAA
    ACACCAATGATTAAATACAAAGTGCCACGTGCATTTGTTGAAATTTCTCCAGAGCTTGCT
    GAAGATAGAGGCATTCATGAAGGTGCAGAAGTTAAGCTGATTTCTGAAACAGGAGAAGCG
    GTATTACAAGTTCACGTGACAGATCGTGTTAAAGGTAAAGAAATCTATATTCCATTAAAT
    AATGATGCGATGGAAAATGGAGATCTAGGTGCAATTAACTTATTAACTAATAGTGATGTT
    GATCAATACACGGATACACCATCTTATAAACGTACTAGCTGTCGTTTGGAGGTAATTACG
    AAACGTGGTAAGTCACCGTTGAACCCTAATAATTTCCGTGTCAATAAAAAACGTCATCCG
    CAGTACAGTGTTCAAGTACAGAAAAAATGGGAACGTTCAGATTATGTTTTCCCGGGAAAT
    CAGGTGGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    2955

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2102 [new locus tag: SA_RS12085 ]
  • symbol: SA2102
  • description: hypothetical protein
  • length: 984
  • theoretical pI: 4.75761
  • theoretical MW: 111294
  • GRAVY: -0.524085

Function[edit source | edit]

  • reaction:
    EC 1.2.1.2?  ExPASy
    Formate dehydrogenaseFormate + NAD+ = CO2 + NADH
  • TIGRFAM:
    formate dehydrogenase, alpha subunit (TIGR01591; EC 1.2.1.2; HMM-score: 807.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismperiplasmic nitrate reductase, large subunit (TIGR01706; EC 1.7.99.4; HMM-score: 288.5)
    MetabolismEnergy metabolismElectron transportperiplasmic nitrate reductase, large subunit (TIGR01706; EC 1.7.99.4; HMM-score: 288.5)
    MetabolismEnergy metabolismAerobicperiplasmic nitrate reductase, large subunit (TIGR01706; EC 1.7.99.4; HMM-score: 288.5)
    oxidoreductase alpha (molybdopterin) subunit (TIGR01701; HMM-score: 249)
    MetabolismEnergy metabolismElectron transportNADH dehydrogenase (quinone), G subunit (TIGR01973; EC 1.6.99.5; HMM-score: 246.6)
    MetabolismEnergy metabolismAnaerobicformate dehydrogenase-N alpha subunit (TIGR01553; EC 1.1.5.6; HMM-score: 227.4)
    MetabolismEnergy metabolismElectron transportformate dehydrogenase-N alpha subunit (TIGR01553; EC 1.1.5.6; HMM-score: 227.4)
    anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family (TIGR02166; HMM-score: 173.5)
    MetabolismEnergy metabolismElectron transportarsenite oxidase, large subunit (TIGR02693; EC 1.20.9.1; HMM-score: 142.4)
    DMSO reductase family type II enzyme, molybdopterin subunit (TIGR03479; HMM-score: 126.4)
    molybdopterin guanine dinucleotide-containing S/N-oxide reductases (TIGR00509; HMM-score: 113.9)
    formylmethanofuran dehydrogenase subunit B (TIGR03129; EC 1.2.99.5; HMM-score: 85.7)
    trimethylamine-N-oxide reductase TorA (TIGR02164; EC 1.7.2.3; HMM-score: 61.1)
    MetabolismEnergy metabolismAnaerobicnitrate reductase, alpha subunit (TIGR01580; EC 1.7.99.4; HMM-score: 49.7)
    [FeFe] hydrogenase, group A (TIGR02512; EC 1.12.-.-; HMM-score: 48.7)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 18.7)
    MetabolismEnergy metabolismElectron transportelectron transport complex, RnfABCDGE type, C subunit (TIGR01945; HMM-score: 17.7)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, subunit C (TIGR02912; EC 1.8.-.-; HMM-score: 16.7)
    MetabolismEnergy metabolismElectron transportNADH-quinone oxidoreductase, chain I (TIGR01971; HMM-score: 16.5)
    MetabolismEnergy metabolismElectron transportferredoxin-type protein NapF (TIGR00402; HMM-score: 14.7)
    Unknown functionGeneralarchaeoflavoprotein, MJ0208 family (TIGR02700; HMM-score: 14.5)
    MetabolismEnergy metabolismElectron transportcytochrome c nitrite reductase, Fe-S protein (TIGR03149; EC 1.7.2.2; HMM-score: 13.7)
    [FeFe] hydrogenase, group B1/B3 (TIGR04105; EC 1.12.-.-; HMM-score: 13.2)
    MetabolismCentral intermediary metabolismNitrogen fixationferredoxin III, nif-specific (TIGR02936; HMM-score: 12.8)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, dissimilatory-type beta subunit (TIGR02066; EC 1.8.99.3; HMM-score: 12.7)
    indolepyruvate ferredoxin oxidoreductase, alpha subunit (TIGR03336; EC 1.2.7.8; HMM-score: 10.4)
    2-oxoacid:acceptor oxidoreductase, delta subunit, pyruvate/2-ketoisovalerate family (TIGR02179; HMM-score: 9.6)
    MetabolismEnergy metabolismElectron transportNADH-plastoquinone oxidoreductase, I subunit (TIGR00403; EC 1.6.5.3; HMM-score: 8.5)
    Genetic information processingProtein fateProtein modification and repair[benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 8.5)
    MetabolismEnergy metabolismAmino acids and aminescholine TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 7.5)
    Genetic information processingProtein fateProtein modification and repairglycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 7.2)
    coenzyme F420 hydrogenase, subunit gamma (TIGR03294; EC 1.12.98.1; HMM-score: 6.8)
    ferredoxin-type protein, NapH/MauN family (TIGR02163; HMM-score: 5.6)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 5.4)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 5.4)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 5.4)
    MetabolismEnergy metabolismMethanogenesisputative methanogenesis marker 16 metalloprotein (TIGR03287; HMM-score: 3.5)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, subunit A (TIGR02910; EC 1.8.-.-; HMM-score: 3.3)
    pyruvate:ferredoxin (flavodoxin) oxidoreductase (TIGR02176; EC 1.2.7.1; HMM-score: 2.3)
  • TheSEED:  
    Formate hydrogenase Probable oxidoreductase YjgC 
  • PFAM:
    no clan definedMolybdopterin; Molybdopterin oxidoreductase (PF00384; HMM-score: 266.1)
    4Fe-4S (CL0344) Molybdop_Fe4S4; Molybdopterin oxidoreductase Fe4S4 domain (PF04879; HMM-score: 69.4)
    AcetylDC-like (CL0332) Molydop_binding; Molydopterin dinucleotide binding domain (PF01568; HMM-score: 67.8)
    4Fe-4S (CL0344) Fer4; 4Fe-4S binding domain (PF00037; HMM-score: 37.4)
    no clan definedNADH-G_4Fe-4S_3; NADH-ubiquinone oxidoreductase-G iron-sulfur binding region (PF10588; HMM-score: 36.4)
    Fer2 (CL0486) Fer2_4; 2Fe-2S iron-sulfur cluster binding domain (PF13510; HMM-score: 34.6)
    4Fe-4S (CL0344) Fer4_7; 4Fe-4S dicluster domain (PF12838; HMM-score: 32.7)
    Fer4_21; 4Fe-4S dicluster domain (PF14697; HMM-score: 31.2)
    Fer4_6; 4Fe-4S binding domain (PF12837; HMM-score: 30.7)
    Fer4_10; 4Fe-4S dicluster domain (PF13237; HMM-score: 23.6)
    Fer4_9; 4Fe-4S dicluster domain (PF13187; HMM-score: 22)
    Fer2 (CL0486) Fer2; 2Fe-2S iron-sulfur cluster binding domain (PF00111; HMM-score: 19.2)
    4Fe-4S (CL0344) Fer4_15; 4Fe-4S single cluster domain (PF13459; HMM-score: 19)
    Fer4_8; 4Fe-4S dicluster domain (PF13183; HMM-score: 17.7)
    Fer4_17; 4Fe-4S dicluster domain (PF13534; HMM-score: 16.7)
    Fer4_2; 4Fe-4S binding domain (PF12797; HMM-score: 15.3)
    C2H2-zf (CL0361) zf-C2HE; C2HE / C2H2 / C2HC zinc-binding finger (PF16278; HMM-score: 14.8)
    4Fe-4S (CL0344) Fer4_13; 4Fe-4S single cluster domain of Ferredoxin I (PF13370; HMM-score: 14.8)
    Fer4_22; 4Fe-4S dicluster domain (PF17179; HMM-score: 12.1)
    Fer4_16; 4Fe-4S double cluster binding domain (PF13484; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mo-bis(molybdopterin guanine dinucleotide), [2Fe-2S] cluster, [4Fe-4S] cluster
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 56
    • Cmax: 0.106
    • Cmax_pos: 34
    • Smax: 0.161
    • Smax_pos: 48
    • Smean: 0.095
    • D: 0.107
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQEHLVVTLDGKDYLVEPGTNLLEFIKSQDTFVPSICYNESMGPIQTCDTCTVEIDGKIERSCSTVIDRPMTVNTVNNDVKDAQKEALDRILEKHMLYCTVCDYNNGDCEIHNTMDAWGLQHQTYEYKEKPYEKDYGPFYRYDPNQCILCGRCVEACQDIEVNETIRIDWDREHPRVIWDNDVPINESSCVSCGQCATVCPCNAMMEVNMEGNAGYMTDTEPGSLAAMIDLTKKAEPGYGPLFAISDSEAEMRKERIKKTKTVCTYCGVGCSFEVWTKDREILKVQPSHDSPANKIATCVKGKFSWGHINSDQRLTKPLVRKNGEFHEVEWDEALNVIADNFTSIKEKYGPDALSFISSSKATNEESYLMQKLARQVIGTNNVDNCSRYCQAPATKGLFRTVGHGGDSGSIEDLEKAAMSVLIGTNTAEAHPVIASRMKRAQKLFGQKIHVFDIRKHEMAERADRFYQPKPGTDLAWLSAVTKYIIDHDLHDKAFIDEWVDDFDEYYKSLETFTMAFAEEATGIPESELIKFAEECAKAESVVICWAMGITQQDIGSDSSTAISNLLLVTGNYRRPGTGAYPLRGHNNVQGCSDMGSMPDKITGYQSIEADDIRAKFEKEYGVKLNPKAGKDNHEMVEGIHDGEVHSLYLYGEDTGIVDSNINFVQAAFEKLDFMVVQDEFLTFTATYADVVLPASPSLEKDGTFTNTERRIQRLYQALEPLGDSKPDWKIFQAIANRLGFDWNYKHPSEIMDEVARLTPLYAGVSYDRLEGFNSLQWPVQPDGTDEPILYLEGFNFDNGKAKLFPLSFDNYFKQDEIYDIHVNNGRLLEHFHEGNMTYQTPMIKYKVPRAFVEISPELAEDRGIHEGAEVKLISETGEAVLQVHVTDRVKGKEIYIPLNNDAMENGDLGAINLLTNSDVDQYTDTPSYKRTSCRLEVITKRGKSPLNPNNFRVNKKRHPQYSVQVQKKWERSDYVFPGNQVDK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]