From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2389 [new locus tag: SA_RS13675 ]
  • pan locus tag?: SAUPAN006291000
  • symbol: truncated-SA
  • pan gene symbol?: truncated-SA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2389 [new locus tag: SA_RS13675 ]
  • symbol: truncated-SA
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2677802..2678308
  • length: 507
  • essential: no DEG

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGACAAAAATTTTTAAAATATCATTTTTGATTTTGTTAGTAGTAATTGTTTCTAGTTAT
    TATGGTGAAAGTTTTGTCTTAGCTGATAATAATCCTATCGTCAATTCAGAAAATGGTAGT
    GATAATAATTTTGAATCAGGAACAATTGAACGTAATCAAAATGAGCTTTATGAAGTAGGT
    GATTATAGTACGCCCTTAACTGAGCGAGTTTTCGGTAAAGATCAAAGAACGGTTGTTAAT
    AATATTTTACAAAGACCTTATAAGCAGACTGTATTATTAAATATGACGTTTTCAAATAAC
    CGTGTATATAAAGGCACCGGTACTATGATTGGTAAGGACATTGTATTGACAGCGGCTCAT
    AATGTCTATTCTAAAGACGATAAGGGTTGGGCTAAAAAGATTGATGTCTATGCTGGAGTA
    AATGGGCAAACATATACAATAGGAAAGGCCTTTTCGCATAAGTTTTTTGTATCTAAAACT
    TGGATTAATAATTTAACCATAGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    507

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2389 [new locus tag: SA_RS13675 ]
  • symbol: Truncated-SA
  • description: hypothetical protein
  • length: 168
  • theoretical pI: 9.43222
  • theoretical MW: 18967.4
  • GRAVY: -0.227381

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    glutamyl endopeptidase precursor 
  • PFAM:
    Peptidase_PA (CL0124) Trypsin; Trypsin (PF00089; HMM-score: 23.6)
    Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 14.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.72
    • Internal Helix: 1
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LADNNPIV
  • SignalP: Signal peptide length 29 aa
    • Ymax: 0.405
    • Ymax_pos: 29
    • Cmax: 0.289
    • Cmax_pos: 29
    • Smax: 0.776
    • Smax_pos: 2
    • Smean: 0.565
    • D: 0.468
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 15928182 NCBI
  • RefSeq: NP_375715 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTKIFKISFLILLVVIVSSYYGESFVLADNNPIVNSENGSDNNFESGTIERNQNELYEVGDYSTPLTERVFGKDQRTVVNNILQRPYKQTVLLNMTFSNNRVYKGTGTMIGKDIVLTAAHNVYSKDDKGWAKKIDVYAGVNGQTYTIGKAFSHKFFVSKTWINNLTIV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]